ID: 1004022232

View in Genome Browser
Species Human (GRCh38)
Location 6:11786435-11786457
Sequence GTGCACATTACGAGGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004022232_1004022236 -5 Left 1004022232 6:11786435-11786457 CCACCTACCCTCGTAATGTGCAC 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1004022236 6:11786453-11786475 TGCACAGAGCCCGTCTCAGATGG 0: 1
1: 0
2: 3
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004022232 Original CRISPR GTGCACATTACGAGGGTAGG TGG (reversed) Intronic
903016831 1:20366901-20366923 GAGCGCATTACGCGGGCAGGAGG + Intergenic
904594252 1:31633085-31633107 GTGGACAGTAGGTGGGTAGGTGG - Intronic
905698754 1:39995978-39996000 TTGCAAATTACAAGGGTAGAGGG + Intergenic
907517913 1:55004973-55004995 GTGCAGTTGACCAGGGTAGGGGG - Intronic
911470139 1:98308332-98308354 GAGCACATTCTGAGGGTAGGAGG - Intergenic
923439006 1:233997589-233997611 ATGCTTATTATGAGGGTAGGAGG - Intronic
924435493 1:244036795-244036817 GTGCACATGAAGAGGGTTGGTGG - Intergenic
1072797675 10:98368409-98368431 TTGCACATTAGGATGTTAGGCGG - Intergenic
1074708508 10:116157655-116157677 GTGCACAGGAGGAGGGGAGGAGG - Intronic
1088599541 11:111462520-111462542 GAGCACATTCAGAGGGCAGGAGG - Intergenic
1104145121 12:126025925-126025947 ATGCACAAGATGAGGGTAGGGGG - Intergenic
1108887780 13:55209560-55209582 GGGCAGATTACGAGGTCAGGAGG - Intergenic
1115443266 14:33460638-33460660 GTGGAAAGTAGGAGGGTAGGAGG - Intronic
1120023947 14:79560924-79560946 GTGCACAGTATGATGGAAGGGGG - Intronic
1134890497 16:17837496-17837518 GTGGACACTACGAGGGCTGGAGG - Intergenic
1137857431 16:51808876-51808898 GTGCACATGAAGAGGGAGGGAGG + Intergenic
1141770350 16:86085984-86086006 GTGCACACCCCGAGGGTAGGAGG - Intergenic
1146458861 17:33028080-33028102 GTGCCTATTAAGAGGGCAGGTGG - Intronic
1152156245 17:78635226-78635248 GGGCACATCACGAGGTCAGGAGG + Intergenic
1153033646 18:738189-738211 GTGGACATTTGGAGGCTAGGAGG + Intronic
1160808496 19:1002900-1002922 GTGCCCATGACAAGGGTAGCTGG + Intronic
935047353 2:99494061-99494083 GAGCACATGCCAAGGGTAGGTGG + Intergenic
942207106 2:173630110-173630132 GTGCACCTTTTGAGGGTGGGAGG - Intergenic
945915281 2:215697185-215697207 GTGGACATCATGTGGGTAGGAGG - Intergenic
949080619 2:242095701-242095723 GAGCACAGAACCAGGGTAGGTGG + Intergenic
1182638566 22:31749347-31749369 GTGGACATCACGAGGGGAGAGGG + Intronic
953208976 3:40857833-40857855 GTGCAAATTTCAAGTGTAGGTGG + Intergenic
953743786 3:45557772-45557794 CAGCACATTACTAGGGTAGAGGG + Intronic
953829975 3:46288201-46288223 GGGCAGATTACGAGGTCAGGAGG + Intergenic
954238893 3:49277822-49277844 GTGCACATAGCGAGGGAAAGGGG + Exonic
957563541 3:81856096-81856118 GTGCACATTACGGTGGCAAGAGG + Intergenic
959551534 3:107665009-107665031 GTACCCATTACGAGATTAGGAGG - Intronic
968815743 4:2820775-2820797 GTGCACAGTAGGAGGGCATGGGG + Intronic
969582077 4:8071456-8071478 ATGCACATTTCGCGGGCAGGCGG + Intronic
974004569 4:56543307-56543329 GGGCAGATCACGAGGGCAGGAGG - Intronic
976068571 4:81216623-81216645 GTGCACATTATTAGGGTAATAGG - Intergenic
978583600 4:110255755-110255777 GGGCAAATCACGAGGCTAGGAGG - Intergenic
981784261 4:148460234-148460256 GTCCACATTACCAGGGAAGAGGG - Intergenic
983680605 4:170349187-170349209 GTGCACATTTCTAGGTTAGTGGG - Intergenic
994397645 5:99238889-99238911 ATGCACATTACAAGGAGAGGGGG + Intergenic
995682657 5:114737608-114737630 GGGCAGATCACGAGGGCAGGAGG + Intergenic
1003751799 6:9066856-9066878 GAGAACAGTACGAGGGTTGGGGG - Intergenic
1004022232 6:11786435-11786457 GTGCACATTACGAGGGTAGGTGG - Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1008479960 6:51975877-51975899 GTGCTGATTACGAGAGTAGCTGG + Intronic
1010126341 6:72436703-72436725 GGGCAGATCACGAGGTTAGGAGG - Intergenic
1018047866 6:159980695-159980717 GTGCAAACTACAAGGGAAGGTGG - Intronic
1023196505 7:37645668-37645690 GTGCAAATTAGGAGGGAAAGGGG + Intergenic
1025831014 7:65049808-65049830 GGGCAGATTACGAGGTCAGGAGG - Intergenic
1025918176 7:65883722-65883744 GGGCAGATTACGAGGTCAGGAGG - Intronic
1035538665 8:413889-413911 GAGCACAGTACCAGGGTAGGTGG + Intronic
1042712593 8:71734832-71734854 GTGGAAATTATGAGGGTAGGAGG + Intergenic
1049852875 8:144843361-144843383 GGGCACATCACGAGGTCAGGAGG + Intronic
1052007599 9:23367715-23367737 GTGCACATTACCAAAGCAGGAGG + Intergenic
1054829384 9:69606716-69606738 GTGCGCATCACGAGGTCAGGAGG - Intronic
1187570572 X:20496599-20496621 GTAGACAGTAAGAGGGTAGGTGG - Intergenic
1201480859 Y:14438004-14438026 GTGCAAATTAGGAGGATGGGCGG + Intergenic