ID: 1004025473

View in Genome Browser
Species Human (GRCh38)
Location 6:11814215-11814237
Sequence GCTGCCCAATACATGCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025473_1004025477 -9 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025477 6:11814229-11814251 TTGGGCAGCTGGTATCCTATGGG No data
1004025473_1004025476 -10 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025476 6:11814228-11814250 ATTGGGCAGCTGGTATCCTATGG No data
1004025473_1004025484 25 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025484 6:11814263-11814285 AGAACTGAGAAGAGGAAGGTGGG No data
1004025473_1004025479 17 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025479 6:11814255-11814277 TTCCCAGCAGAACTGAGAAGAGG No data
1004025473_1004025485 26 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025485 6:11814264-11814286 GAACTGAGAAGAGGAAGGTGGGG No data
1004025473_1004025482 21 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025482 6:11814259-11814281 CAGCAGAACTGAGAAGAGGAAGG No data
1004025473_1004025483 24 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025483 6:11814262-11814284 CAGAACTGAGAAGAGGAAGGTGG No data
1004025473_1004025486 27 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025486 6:11814265-11814287 AACTGAGAAGAGGAAGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025473 Original CRISPR GCTGCCCAATACATGCTTGG TGG (reversed) Intergenic
No off target data available for this crispr