ID: 1004025474

View in Genome Browser
Species Human (GRCh38)
Location 6:11814218-11814240
Sequence CCAGCTGCCCAATACATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025474_1004025484 22 Left 1004025474 6:11814218-11814240 CCAAGCATGTATTGGGCAGCTGG No data
Right 1004025484 6:11814263-11814285 AGAACTGAGAAGAGGAAGGTGGG No data
1004025474_1004025483 21 Left 1004025474 6:11814218-11814240 CCAAGCATGTATTGGGCAGCTGG No data
Right 1004025483 6:11814262-11814284 CAGAACTGAGAAGAGGAAGGTGG No data
1004025474_1004025479 14 Left 1004025474 6:11814218-11814240 CCAAGCATGTATTGGGCAGCTGG No data
Right 1004025479 6:11814255-11814277 TTCCCAGCAGAACTGAGAAGAGG No data
1004025474_1004025485 23 Left 1004025474 6:11814218-11814240 CCAAGCATGTATTGGGCAGCTGG No data
Right 1004025485 6:11814264-11814286 GAACTGAGAAGAGGAAGGTGGGG No data
1004025474_1004025486 24 Left 1004025474 6:11814218-11814240 CCAAGCATGTATTGGGCAGCTGG No data
Right 1004025486 6:11814265-11814287 AACTGAGAAGAGGAAGGTGGGGG No data
1004025474_1004025482 18 Left 1004025474 6:11814218-11814240 CCAAGCATGTATTGGGCAGCTGG No data
Right 1004025482 6:11814259-11814281 CAGCAGAACTGAGAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025474 Original CRISPR CCAGCTGCCCAATACATGCT TGG (reversed) Intergenic