ID: 1004025477

View in Genome Browser
Species Human (GRCh38)
Location 6:11814229-11814251
Sequence TTGGGCAGCTGGTATCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025473_1004025477 -9 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025477 6:11814229-11814251 TTGGGCAGCTGGTATCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025477 Original CRISPR TTGGGCAGCTGGTATCCTAT GGG Intergenic
No off target data available for this crispr