ID: 1004025478

View in Genome Browser
Species Human (GRCh38)
Location 6:11814244-11814266
Sequence TTCTGCTGGGAAAAGCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025478_1004025483 -5 Left 1004025478 6:11814244-11814266 CCTATGGGCTTTTCCCAGCAGAA No data
Right 1004025483 6:11814262-11814284 CAGAACTGAGAAGAGGAAGGTGG No data
1004025478_1004025482 -8 Left 1004025478 6:11814244-11814266 CCTATGGGCTTTTCCCAGCAGAA No data
Right 1004025482 6:11814259-11814281 CAGCAGAACTGAGAAGAGGAAGG No data
1004025478_1004025485 -3 Left 1004025478 6:11814244-11814266 CCTATGGGCTTTTCCCAGCAGAA No data
Right 1004025485 6:11814264-11814286 GAACTGAGAAGAGGAAGGTGGGG No data
1004025478_1004025487 13 Left 1004025478 6:11814244-11814266 CCTATGGGCTTTTCCCAGCAGAA No data
Right 1004025487 6:11814280-11814302 GGTGGGGGAGCCCAGCTTCTCGG No data
1004025478_1004025486 -2 Left 1004025478 6:11814244-11814266 CCTATGGGCTTTTCCCAGCAGAA No data
Right 1004025486 6:11814265-11814287 AACTGAGAAGAGGAAGGTGGGGG No data
1004025478_1004025484 -4 Left 1004025478 6:11814244-11814266 CCTATGGGCTTTTCCCAGCAGAA No data
Right 1004025484 6:11814263-11814285 AGAACTGAGAAGAGGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025478 Original CRISPR TTCTGCTGGGAAAAGCCCAT AGG (reversed) Intergenic
No off target data available for this crispr