ID: 1004025486

View in Genome Browser
Species Human (GRCh38)
Location 6:11814265-11814287
Sequence AACTGAGAAGAGGAAGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025474_1004025486 24 Left 1004025474 6:11814218-11814240 CCAAGCATGTATTGGGCAGCTGG No data
Right 1004025486 6:11814265-11814287 AACTGAGAAGAGGAAGGTGGGGG No data
1004025478_1004025486 -2 Left 1004025478 6:11814244-11814266 CCTATGGGCTTTTCCCAGCAGAA No data
Right 1004025486 6:11814265-11814287 AACTGAGAAGAGGAAGGTGGGGG No data
1004025473_1004025486 27 Left 1004025473 6:11814215-11814237 CCACCAAGCATGTATTGGGCAGC No data
Right 1004025486 6:11814265-11814287 AACTGAGAAGAGGAAGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025486 Original CRISPR AACTGAGAAGAGGAAGGTGG GGG Intergenic
No off target data available for this crispr