ID: 1004025598

View in Genome Browser
Species Human (GRCh38)
Location 6:11815291-11815313
Sequence TGCCTTGGGCCAATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025598_1004025610 27 Left 1004025598 6:11815291-11815313 CCAGCCTCCATTGGCCCAAGGCA No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025598_1004025605 5 Left 1004025598 6:11815291-11815313 CCAGCCTCCATTGGCCCAAGGCA No data
Right 1004025605 6:11815319-11815341 CCTCAGAAGACTGCACTCCCAGG No data
1004025598_1004025609 26 Left 1004025598 6:11815291-11815313 CCAGCCTCCATTGGCCCAAGGCA No data
Right 1004025609 6:11815340-11815362 GGAAAATGCCAAGCTGGAGCTGG No data
1004025598_1004025606 20 Left 1004025598 6:11815291-11815313 CCAGCCTCCATTGGCCCAAGGCA No data
Right 1004025606 6:11815334-11815356 CTCCCAGGAAAATGCCAAGCTGG No data
1004025598_1004025611 30 Left 1004025598 6:11815291-11815313 CCAGCCTCCATTGGCCCAAGGCA No data
Right 1004025611 6:11815344-11815366 AATGCCAAGCTGGAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025598 Original CRISPR TGCCTTGGGCCAATGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr