ID: 1004025599

View in Genome Browser
Species Human (GRCh38)
Location 6:11815295-11815317
Sequence AACTTGCCTTGGGCCAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025599_1004025605 1 Left 1004025599 6:11815295-11815317 CCTCCATTGGCCCAAGGCAAGTT No data
Right 1004025605 6:11815319-11815341 CCTCAGAAGACTGCACTCCCAGG No data
1004025599_1004025612 27 Left 1004025599 6:11815295-11815317 CCTCCATTGGCCCAAGGCAAGTT No data
Right 1004025612 6:11815345-11815367 ATGCCAAGCTGGAGCTGGGAGGG No data
1004025599_1004025611 26 Left 1004025599 6:11815295-11815317 CCTCCATTGGCCCAAGGCAAGTT No data
Right 1004025611 6:11815344-11815366 AATGCCAAGCTGGAGCTGGGAGG No data
1004025599_1004025606 16 Left 1004025599 6:11815295-11815317 CCTCCATTGGCCCAAGGCAAGTT No data
Right 1004025606 6:11815334-11815356 CTCCCAGGAAAATGCCAAGCTGG No data
1004025599_1004025610 23 Left 1004025599 6:11815295-11815317 CCTCCATTGGCCCAAGGCAAGTT No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025599_1004025609 22 Left 1004025599 6:11815295-11815317 CCTCCATTGGCCCAAGGCAAGTT No data
Right 1004025609 6:11815340-11815362 GGAAAATGCCAAGCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025599 Original CRISPR AACTTGCCTTGGGCCAATGG AGG (reversed) Intergenic
No off target data available for this crispr