ID: 1004025603

View in Genome Browser
Species Human (GRCh38)
Location 6:11815318-11815340
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025603_1004025616 15 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025616 6:11815356-11815378 GAGCTGGGAGGGATGAGGGCTGG No data
1004025603_1004025609 -1 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025609 6:11815340-11815362 GGAAAATGCCAAGCTGGAGCTGG No data
1004025603_1004025615 11 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025615 6:11815352-11815374 GCTGGAGCTGGGAGGGATGAGGG No data
1004025603_1004025612 4 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025612 6:11815345-11815367 ATGCCAAGCTGGAGCTGGGAGGG No data
1004025603_1004025617 27 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025617 6:11815368-11815390 ATGAGGGCTGGTATAAAAAAAGG No data
1004025603_1004025610 0 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025603_1004025611 3 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025611 6:11815344-11815366 AATGCCAAGCTGGAGCTGGGAGG No data
1004025603_1004025614 10 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025614 6:11815351-11815373 AGCTGGAGCTGGGAGGGATGAGG No data
1004025603_1004025606 -7 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025606 6:11815334-11815356 CTCCCAGGAAAATGCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025603 Original CRISPR CTGGGAGTGCAGTCTTCTGA GGG (reversed) Intergenic
No off target data available for this crispr