ID: 1004025610

View in Genome Browser
Species Human (GRCh38)
Location 6:11815341-11815363
Sequence GAAAATGCCAAGCTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004025598_1004025610 27 Left 1004025598 6:11815291-11815313 CCAGCCTCCATTGGCCCAAGGCA No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025603_1004025610 0 Left 1004025603 6:11815318-11815340 CCCTCAGAAGACTGCACTCCCAG No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025604_1004025610 -1 Left 1004025604 6:11815319-11815341 CCTCAGAAGACTGCACTCCCAGG No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025599_1004025610 23 Left 1004025599 6:11815295-11815317 CCTCCATTGGCCCAAGGCAAGTT No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025601_1004025610 13 Left 1004025601 6:11815305-11815327 CCCAAGGCAAGTTCCCTCAGAAG No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025600_1004025610 20 Left 1004025600 6:11815298-11815320 CCATTGGCCCAAGGCAAGTTCCC No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025602_1004025610 12 Left 1004025602 6:11815306-11815328 CCAAGGCAAGTTCCCTCAGAAGA No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data
1004025597_1004025610 28 Left 1004025597 6:11815290-11815312 CCCAGCCTCCATTGGCCCAAGGC No data
Right 1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004025610 Original CRISPR GAAAATGCCAAGCTGGAGCT GGG Intergenic
No off target data available for this crispr