ID: 1004027520

View in Genome Browser
Species Human (GRCh38)
Location 6:11833603-11833625
Sequence GTGAAGAATCAGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004027517_1004027520 4 Left 1004027517 6:11833576-11833598 CCATTAGAATAGGAAGCAGTGAA No data
Right 1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004027520 Original CRISPR GTGAAGAATCAGAGTGAGGA AGG Intergenic
No off target data available for this crispr