ID: 1004029823

View in Genome Browser
Species Human (GRCh38)
Location 6:11855949-11855971
Sequence ACAGAAGACACTAGTAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004029820_1004029823 20 Left 1004029820 6:11855906-11855928 CCAAGGGATGCAAATCAAACTGG No data
Right 1004029823 6:11855949-11855971 ACAGAAGACACTAGTAGATAGGG No data
1004029819_1004029823 27 Left 1004029819 6:11855899-11855921 CCACATGCCAAGGGATGCAAATC No data
Right 1004029823 6:11855949-11855971 ACAGAAGACACTAGTAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004029823 Original CRISPR ACAGAAGACACTAGTAGATA GGG Intergenic
No off target data available for this crispr