ID: 1004036289

View in Genome Browser
Species Human (GRCh38)
Location 6:11927447-11927469
Sequence CAACTTGCAATGTAAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004036283_1004036289 16 Left 1004036283 6:11927408-11927430 CCTTTCTGTTGCTTCAGGGCAAC No data
Right 1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG No data
1004036282_1004036289 17 Left 1004036282 6:11927407-11927429 CCCTTTCTGTTGCTTCAGGGCAA No data
Right 1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG No data
1004036285_1004036289 -9 Left 1004036285 6:11927433-11927455 CCAGATAAACTCCCCAACTTGCA No data
Right 1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG No data
1004036284_1004036289 -6 Left 1004036284 6:11927430-11927452 CCGCCAGATAAACTCCCCAACTT No data
Right 1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004036289 Original CRISPR CAACTTGCAATGTAAAAATC TGG Intergenic
No off target data available for this crispr