ID: 1004037254

View in Genome Browser
Species Human (GRCh38)
Location 6:11935531-11935553
Sequence GTAACACGGGACCATGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004037248_1004037254 -1 Left 1004037248 6:11935509-11935531 CCTGTATCTAATGTGGTGAAGGG No data
Right 1004037254 6:11935531-11935553 GTAACACGGGACCATGGAGAGGG No data
1004037245_1004037254 22 Left 1004037245 6:11935486-11935508 CCTTGGTATAACGGAGATCTCAA No data
Right 1004037254 6:11935531-11935553 GTAACACGGGACCATGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004037254 Original CRISPR GTAACACGGGACCATGGAGA GGG Intergenic
No off target data available for this crispr