ID: 1004037266

View in Genome Browser
Species Human (GRCh38)
Location 6:11935575-11935597
Sequence GTAACACGGGACCATGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004037257_1004037266 10 Left 1004037257 6:11935542-11935564 CCATGGAGAGGGTAACACGGGAC No data
Right 1004037266 6:11935575-11935597 GTAACACGGGACCATGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004037266 Original CRISPR GTAACACGGGACCATGGAGA GGG Intergenic
No off target data available for this crispr