ID: 1004039347

View in Genome Browser
Species Human (GRCh38)
Location 6:11960490-11960512
Sequence CTGACTATAGAAATGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004039341_1004039347 19 Left 1004039341 6:11960448-11960470 CCAGACTCCCCAACACAGAGGTG No data
Right 1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG No data
1004039338_1004039347 28 Left 1004039338 6:11960439-11960461 CCCAGCACTCCAGACTCCCCAAC No data
Right 1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG No data
1004039339_1004039347 27 Left 1004039339 6:11960440-11960462 CCAGCACTCCAGACTCCCCAACA No data
Right 1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG No data
1004039337_1004039347 29 Left 1004039337 6:11960438-11960460 CCCCAGCACTCCAGACTCCCCAA No data
Right 1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG No data
1004039342_1004039347 12 Left 1004039342 6:11960455-11960477 CCCCAACACAGAGGTGTGTGTTC No data
Right 1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG No data
1004039344_1004039347 10 Left 1004039344 6:11960457-11960479 CCAACACAGAGGTGTGTGTTCAG No data
Right 1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG No data
1004039343_1004039347 11 Left 1004039343 6:11960456-11960478 CCCAACACAGAGGTGTGTGTTCA No data
Right 1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004039347 Original CRISPR CTGACTATAGAAATGGGCAA TGG Intergenic
No off target data available for this crispr