ID: 1004039421

View in Genome Browser
Species Human (GRCh38)
Location 6:11961068-11961090
Sequence CAGAGGGTGCAGGGTTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004039421_1004039428 7 Left 1004039421 6:11961068-11961090 CCTTTCTAACCCTGCACCCTCTG No data
Right 1004039428 6:11961098-11961120 TGCTTCCTCCACCCTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004039421 Original CRISPR CAGAGGGTGCAGGGTTAGAA AGG (reversed) Intergenic
No off target data available for this crispr