ID: 1004039423

View in Genome Browser
Species Human (GRCh38)
Location 6:11961077-11961099
Sequence CATTCCAGGCAGAGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004039423_1004039428 -2 Left 1004039423 6:11961077-11961099 CCCTGCACCCTCTGCCTGGAATG No data
Right 1004039428 6:11961098-11961120 TGCTTCCTCCACCCTCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004039423 Original CRISPR CATTCCAGGCAGAGGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr