ID: 1004044712

View in Genome Browser
Species Human (GRCh38)
Location 6:12012529-12012551
Sequence TGCAGCGGCAGCGGCTCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004044705_1004044712 5 Left 1004044705 6:12012501-12012523 CCATCAGCAGCGCAGCTCCAGGG 0: 1
1: 0
2: 1
3: 39
4: 279
Right 1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG 0: 1
1: 0
2: 0
3: 36
4: 272
1004044702_1004044712 11 Left 1004044702 6:12012495-12012517 CCGCCGCCATCAGCAGCGCAGCT 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG 0: 1
1: 0
2: 0
3: 36
4: 272
1004044699_1004044712 23 Left 1004044699 6:12012483-12012505 CCCGAGCCGCGGCCGCCGCCATC 0: 1
1: 1
2: 10
3: 95
4: 705
Right 1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG 0: 1
1: 0
2: 0
3: 36
4: 272
1004044701_1004044712 17 Left 1004044701 6:12012489-12012511 CCGCGGCCGCCGCCATCAGCAGC 0: 1
1: 1
2: 7
3: 48
4: 398
Right 1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG 0: 1
1: 0
2: 0
3: 36
4: 272
1004044703_1004044712 8 Left 1004044703 6:12012498-12012520 CCGCCATCAGCAGCGCAGCTCCA 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG 0: 1
1: 0
2: 0
3: 36
4: 272
1004044700_1004044712 22 Left 1004044700 6:12012484-12012506 CCGAGCCGCGGCCGCCGCCATCA 0: 1
1: 0
2: 5
3: 27
4: 247
Right 1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG 0: 1
1: 0
2: 0
3: 36
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004044712 Original CRISPR TGCAGCGGCAGCGGCTCCGC CGG Exonic