ID: 1004049071

View in Genome Browser
Species Human (GRCh38)
Location 6:12056317-12056339
Sequence ATGATGTTCTTAAGGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004049069_1004049071 -5 Left 1004049069 6:12056299-12056321 CCTTAGACTCGAGGTAGTATGAT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG 0: 1
1: 0
2: 0
3: 30
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004049071 Original CRISPR ATGATGTTCTTAAGGAAAAG TGG Intronic
901549980 1:9988978-9989000 ATGATATTGCTAAGGAAAGGAGG + Intergenic
902795430 1:18797895-18797917 ATGGTGTTATTATGGAAAAGCGG - Intergenic
905438299 1:37975018-37975040 ATGAGTTTCTTAAGGGCAAGAGG + Intronic
905638666 1:39573924-39573946 ATCATAGCCTTAAGGAAAAGTGG - Intronic
906740719 1:48181218-48181240 AAGACGGACTTAAGGAAAAGGGG + Intergenic
907149256 1:52267591-52267613 ATGATCTTCAAAAGGAAAGGTGG - Intronic
908426557 1:64013544-64013566 AAGGTGTGCTTAAGTAAAAGAGG - Intronic
908489356 1:64627540-64627562 ATGATGCTCTAGAGGAGAAGAGG + Intronic
908734390 1:67260604-67260626 ATGATGTCAATATGGAAAAGTGG + Intergenic
909520853 1:76566050-76566072 ATTCTGTTTTTAAAGAAAAGAGG + Intronic
910538347 1:88325668-88325690 CTAATGTTTTTAAGGATAAGAGG + Intergenic
911766719 1:101685386-101685408 ATGTTCTTATTTAGGAAAAGAGG + Intergenic
914424510 1:147562712-147562734 ATGATGCTCTTAAGAGAAAGTGG + Intronic
915003008 1:152610788-152610810 AAGTTATTCTTAAGGAAAATGGG - Intergenic
916155743 1:161845240-161845262 CTGTGGTTCTAAAGGAAAAGCGG - Intronic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917825212 1:178812783-178812805 CCCATGTTCTTAAGGAAAATAGG - Intronic
917920773 1:179747924-179747946 GTGATGTTCCTAGGGAAAGGGGG + Intronic
918076207 1:181173389-181173411 ATGATGTTCGATGGGAAAAGAGG - Intergenic
918223339 1:182456017-182456039 ATGAGGGTCTAAAGGGAAAGGGG + Intronic
919579208 1:199350213-199350235 ATGATTTTCTTAATGATATGTGG - Intergenic
919603954 1:199657102-199657124 ATGGTGTTCTTAAAGATAAAAGG - Intergenic
920088278 1:203433909-203433931 ATGAAGAATTTAAGGAAAAGAGG - Intergenic
920330052 1:205200616-205200638 TTGATGTTATGAAGGAAAAAAGG - Intronic
920509679 1:206541675-206541697 ATGATGTTCCTTAGCAAATGAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923348158 1:233077809-233077831 ATGATTTTTTAAATGAAAAGTGG - Intronic
1063323839 10:5077427-5077449 ATGATGTTCTTGTGGGAAACTGG + Intronic
1064516667 10:16156722-16156744 ATGAGATGCTTAAGGAAACGTGG + Intergenic
1065598110 10:27337490-27337512 ATGATTTTCTATATGAAAAGGGG - Intergenic
1066015965 10:31243865-31243887 ATGATGCTCTCAATGAAAAATGG - Intergenic
1066542976 10:36469057-36469079 ATAGTTTTCTTAATGAAAAGAGG - Intergenic
1067024541 10:42832550-42832572 ATGATGTTGTAAAGGCAATGTGG - Exonic
1071229468 10:83568461-83568483 AAGATTTCCTTAAGGGAAAGAGG - Intergenic
1071975244 10:90948785-90948807 AAGATTTTCTGATGGAAAAGTGG + Intergenic
1072226520 10:93375151-93375173 TTGATGTTCATAAGGAATACAGG + Intronic
1072519160 10:96215000-96215022 ATGATGTTCTGAAAGAACTGTGG + Intronic
1073531517 10:104236844-104236866 ATGATGTTGTTATAGGAAAGGGG - Intronic
1073789960 10:106929938-106929960 TTAATTTTCTTAAGCAAAAGAGG - Intronic
1075259659 10:120951675-120951697 ATGATCCTCTTAATAAAAAGAGG + Intergenic
1075993571 10:126858736-126858758 ATGATCTTGTTAAGGGAACGTGG - Intergenic
1076145219 10:128113431-128113453 ATGATTTTCTTCAGGACAGGTGG + Exonic
1077757754 11:5053489-5053511 ATGCTGCTCTTAAAGATAAGTGG - Intergenic
1077765315 11:5152803-5152825 AAAATGTTCTTAAAGAAAATTGG - Intronic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1078275810 11:9844979-9845001 GTGATGTACTTAAGGATAAAGGG + Intronic
1079364676 11:19798990-19799012 ATGAGGTGGTTAAGGAGAAGAGG + Intronic
1079409395 11:20173074-20173096 TGCATGTTATTAAGGAAAAGGGG + Intergenic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1079888718 11:26023133-26023155 ATGATGTTTTTACGGGAAACAGG - Intergenic
1080691142 11:34559058-34559080 ATGGTTTTCTTAAGGGACAGAGG + Intergenic
1081442053 11:43091421-43091443 ATGCAGTTCTCAAGGATAAGGGG + Intergenic
1081919946 11:46765293-46765315 ATCATATTCTTAAGGAGAAGTGG - Intronic
1082188123 11:49208907-49208929 ATAATATTCTTTAGGAAAAAGGG - Intergenic
1085648890 11:78249006-78249028 ATCATGTTCTTCATGAAAATGGG + Intronic
1085840381 11:80004884-80004906 CTGATGTCCTTAAAAAAAAGAGG - Intergenic
1085866146 11:80295995-80296017 ATGATATTCTTAAATAAAATTGG + Intergenic
1088762118 11:112941518-112941540 CTGATTTTCCTAAGGCAAAGTGG + Intergenic
1089361558 11:117891655-117891677 AGGATGTTCTTAAGTGAAACTGG - Intergenic
1089442079 11:118525794-118525816 TTTTTGTTTTTAAGGAAAAGCGG + Exonic
1089498698 11:118920624-118920646 TCGGTGTTCTAAAGGAAAAGGGG - Intronic
1089928719 11:122287111-122287133 AAGATGTGATTTAGGAAAAGAGG + Intergenic
1089966922 11:122660932-122660954 GTGAAGATATTAAGGAAAAGAGG - Intronic
1090952188 11:131483546-131483568 ATTAAGTTCTTAAGGAGAGGCGG + Intronic
1091146049 11:133281306-133281328 GTGCTGTTCTTAAGGTAATGTGG + Intronic
1091158795 11:133400019-133400041 GTGATGTTCTTATGGAAGACAGG - Intronic
1091324003 11:134670688-134670710 AGGATATTCTTTAGGAAAACTGG - Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1092972312 12:13708402-13708424 ATGATCTTCGTATGGAAAAAGGG - Intronic
1093362583 12:18248652-18248674 ATGATGATCTTAAGGAGCATTGG - Intronic
1093895799 12:24573019-24573041 ATGACTCTCTTAATGAAAAGAGG - Intergenic
1094770605 12:33653857-33653879 ATGGTTTTCTGAAGGAAAAAAGG + Intergenic
1096436846 12:51598895-51598917 ATGTATTTCTTAAGGAAAAGGGG - Intronic
1097535335 12:60862751-60862773 ATGATGTTCTTAACTAACATAGG + Intergenic
1098540994 12:71657637-71657659 ATTATTTTCTGAAGGAAGAGGGG + Intronic
1098547208 12:71724909-71724931 ATTATTTACTTAAGGAAAATGGG + Intergenic
1099284047 12:80693003-80693025 ATGATTTTTTTAAGTAAGAGAGG + Intergenic
1099336151 12:81360957-81360979 AGAATGTTATTAAGGAAAACAGG + Intronic
1099627187 12:85090098-85090120 ATGATGTGCATTAGGCAAAGTGG - Intronic
1100806129 12:98285539-98285561 ATGGTGTTCCTAAGGGAAATTGG - Intergenic
1100888889 12:99102078-99102100 ATGAAGTTAATGAGGAAAAGAGG + Intronic
1102173702 12:110860894-110860916 AGGAAGTTTTTAAAGAAAAGAGG + Intronic
1102949764 12:117023527-117023549 AAGAGGTTCTTAAAGAAATGGGG + Intronic
1105501926 13:20980397-20980419 ATGAGGCTCTGAAGGAAAAGTGG - Intronic
1106864660 13:33950236-33950258 GGGATGTTCTTAAATAAAAGTGG + Intronic
1106875228 13:34064791-34064813 AGGAGGTTTTTAAGGGAAAGTGG + Intergenic
1108771623 13:53708973-53708995 ATGATGATGATAAAGAAAAGGGG + Intergenic
1108946923 13:56038303-56038325 ATGTTGGTAGTAAGGAAAAGAGG + Intergenic
1110097560 13:71548332-71548354 ATGATGTTTTTATGGAATAAAGG - Intronic
1110399823 13:75076922-75076944 AAGAATTTCTTAAGGAAATGTGG - Intergenic
1110600448 13:77366354-77366376 ATGATATTCTTAAGTAAAACTGG - Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111758272 13:92427026-92427048 AAGATGTTCTTAACTAAAATAGG - Intronic
1112848694 13:103676450-103676472 ATGGTTTCCTTCAGGAAAAGTGG - Intergenic
1112907062 13:104435829-104435851 ATTATGTTTATAAGGAAAACAGG + Intergenic
1113065153 13:106365841-106365863 AATATATTCTTAAGGAAAAATGG + Intergenic
1113362567 13:109644941-109644963 ATAATATAATTAAGGAAAAGGGG + Intergenic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1113616193 13:111682297-111682319 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1113621661 13:111767190-111767212 AAGATGTTCTAAAGGAAAAATGG + Intergenic
1116565139 14:46435404-46435426 AAGATGTTCCTACTGAAAAGAGG + Intergenic
1116734992 14:48677904-48677926 AAGATGTTCTTAAGTTAAACTGG + Intergenic
1119119690 14:72063126-72063148 ATGAAATTCTTGAGGAAAGGAGG + Intronic
1119812266 14:77532043-77532065 TTGTTGTTTTTAAGTAAAAGGGG - Intronic
1120671786 14:87370967-87370989 AAGATGTTTTAAAGGAAATGTGG - Intergenic
1122107053 14:99466200-99466222 ATGATTATTTTAAGGCAAAGTGG - Intronic
1125204257 15:37134349-37134371 CTGATGTTCTTAGGGAATGGGGG + Intergenic
1126465492 15:48957829-48957851 CTGATGTTCTTATAAAAAAGAGG + Intronic
1126659927 15:51023054-51023076 ATAATGATCTTAAGGAAACTCGG - Intergenic
1126871739 15:52996631-52996653 ATGATGTTCTCATGGGAAAGTGG + Intergenic
1127021431 15:54752972-54752994 ATGATGTTCATCAGGAATATTGG - Intergenic
1127230987 15:56994814-56994836 AAGATGTTCTTAAGACAAAAGGG + Intronic
1130790716 15:87153122-87153144 AAGGTGTTCTTAAGGTTAAGGGG - Intergenic
1130882969 15:88070800-88070822 ATGATGTTCTTGACAACAAGGGG + Intronic
1131931443 15:97447006-97447028 ATGAGGTTTTTAAGGACAGGGGG + Intergenic
1132286622 15:100668306-100668328 ATGATTTTCTTTAGTACAAGAGG - Intergenic
1133426567 16:5695793-5695815 ATGCTCTTCTAAAGGAAAGGAGG + Intergenic
1135873467 16:26174175-26174197 AAGATATTCTTATTGAAAAGAGG - Intergenic
1136859129 16:33685852-33685874 ATGATGTTGTAAAGGCAATGTGG + Intergenic
1137453801 16:48602569-48602591 ATCATCTTCTTAAGAAACAGTGG - Intronic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1139276824 16:65735662-65735684 ATAATTTTATAAAGGAAAAGAGG + Intergenic
1140728256 16:77833443-77833465 AGGAGGTTCTTCATGAAAAGTGG + Intronic
1141354527 16:83332390-83332412 ATGATGTTCTTAAAAAAATTAGG - Intronic
1203120640 16_KI270728v1_random:1534036-1534058 ATGATGTTGTAAAGGCAATGTGG + Intergenic
1142773918 17:2120962-2120984 ATGATGAGCTTAAAAAAAAGCGG + Intronic
1143726194 17:8848289-8848311 ATGCTGTCTTTTAGGAAAAGAGG - Intronic
1144460110 17:15451608-15451630 TTGATGTTTTTAAAGAAGAGAGG - Intronic
1144511642 17:15882071-15882093 TTCGTGTCCTTAAGGAAAAGGGG + Intergenic
1147619245 17:41853485-41853507 AAGATCTTATTAAGGACAAGTGG - Intergenic
1148289768 17:46434636-46434658 ATGGTGTCCTGAAGGAAGAGTGG - Intergenic
1148311936 17:46652208-46652230 ATGGTGTCCTGAAGGAAGAGTGG - Intronic
1149153903 17:53603284-53603306 TTGATGTTCTTAAACAAAAACGG - Intergenic
1149676729 17:58471315-58471337 ATTTTGTGCTTATGGAAAAGAGG - Intronic
1150356170 17:64486730-64486752 ATGGTGTGCTTTAGGGAAAGGGG + Intronic
1153185523 18:2481877-2481899 ATGATGTTGTTTAGTGAAAGGGG - Intergenic
1155275094 18:24179472-24179494 ATGATCTACATAAGGAAAAAAGG + Intronic
1155591325 18:27430077-27430099 ATGATGATCTTAAGGAAACCTGG + Intergenic
1156013147 18:32516908-32516930 ATTCTGTACTTATGGAAAAGTGG + Intergenic
1156153827 18:34277428-34277450 ATGATGTTAATAAGGCAAAAAGG - Intergenic
1156639489 18:39073409-39073431 AATATGTTTTTAAGGAGAAGAGG + Intergenic
1157316564 18:46594731-46594753 ATGATGTGCTTAAAGAAATACGG - Intronic
1158668377 18:59453132-59453154 AGGATGATCTTTAGGAACAGGGG - Intronic
1160008131 18:75083400-75083422 ATCACTTTCTCAAGGAAAAGAGG - Intergenic
1160045286 18:75380843-75380865 AGGATGATCTGAAGGAAATGAGG - Intergenic
1163864150 19:19758221-19758243 ATGATGACCGTAATGAAAAGTGG - Intergenic
1164456268 19:28409882-28409904 ATGATTTTTTTAAGGAACACTGG - Intergenic
1165503281 19:36207183-36207205 ATTTTATTCTTAAGGAAAACAGG + Intronic
1166576399 19:43842867-43842889 AAGATGTTCTTAAGTGAAAATGG - Intronic
926774788 2:16411237-16411259 ATGATGTTCTTGAGTAGATGGGG - Intergenic
926822162 2:16864143-16864165 AGAATGTTCTTAAGAAAATGGGG + Intergenic
927963245 2:27254041-27254063 ATGCAGTTCTTAAGACAAAGGGG + Intronic
928804183 2:35130927-35130949 AAGATGGTCTTAAAGAAAACTGG - Intergenic
930929141 2:56859840-56859862 AAGAGGTTCTTAAGGAAACATGG - Intergenic
931402800 2:61946774-61946796 ATGAAGTTGTAAAGGAAATGTGG - Intronic
931643602 2:64402475-64402497 ATAAAGTTCTTTAGGGAAAGAGG - Intergenic
932034692 2:68231681-68231703 GTGATATTCTTAAGCAAAAGTGG + Intronic
932404969 2:71506729-71506751 CTGAGGCTCTTAAGGGAAAGTGG - Intronic
934863677 2:97786925-97786947 ATATAGTTCTGAAGGAAAAGGGG - Intronic
935465922 2:103398066-103398088 ATGATCTGCTTGAGGTAAAGTGG - Intergenic
935982275 2:108639074-108639096 CTGGTGTTCTTAAGGAGATGAGG + Intronic
936483846 2:112909817-112909839 ATGAGATTGTGAAGGAAAAGAGG - Intergenic
938272322 2:129983990-129984012 ATTAAATTCTTAAGTAAAAGGGG + Intergenic
938660025 2:133476885-133476907 AAGCTGTTCTGAAAGAAAAGAGG - Intronic
938756664 2:134386780-134386802 ATTCTGTTCATAAGGAAAAGGGG + Intronic
939392854 2:141591237-141591259 ATGCTGTTCTTAGGGACATGGGG - Intronic
940342608 2:152597508-152597530 ATGATATTCTTAAGTGAAACTGG + Intronic
940355231 2:152734177-152734199 ATAATGGACTTAAGGAAAAACGG - Intronic
940963879 2:159816285-159816307 ATAATTTTCTAGAGGAAAAGTGG + Intronic
941706968 2:168669138-168669160 ATTATGTTATTAAGGATATGGGG + Intronic
941849917 2:170169864-170169886 AACATGTCCTTAAGAAAAAGAGG - Intergenic
942625682 2:177897633-177897655 ATGGTCTTCTTAAGGCAAGGAGG - Intronic
942771186 2:179523068-179523090 ATGATTTTCATTAGAAAAAGTGG - Intronic
944855853 2:203765808-203765830 ATAATGTTCTCAAGGACAAAAGG + Intergenic
945176560 2:207049419-207049441 ATGAAGTTTTTATGAAAAAGGGG + Intergenic
945469049 2:210205959-210205981 ATGATGTTATCAAGGATCAGGGG + Intronic
947189491 2:227487659-227487681 ATGAGGTTCTTAATAAAAATTGG + Intronic
948819944 2:240537415-240537437 GTGAGGTTTTAAAGGAAAAGGGG - Intronic
1169875686 20:10294757-10294779 ATGACTTTCTTAATGAACAGTGG - Intronic
1173194653 20:40904449-40904471 AGGATTTTCTGAAGGAATAGAGG + Intergenic
1176276696 20:64276098-64276120 ATGATGTTAATAAAGAAAAAAGG - Exonic
1177330278 21:19650673-19650695 ATGATTTTGCTAAAGAAAAGTGG - Intergenic
1177504737 21:22005875-22005897 CTGATGTTCTTATAAAAAAGAGG + Intergenic
1178181503 21:30167155-30167177 ATTACCATCTTAAGGAAAAGTGG - Intergenic
1179061393 21:37982740-37982762 TTGATGTTCTTAAGAATCAGAGG - Intronic
1179451718 21:41472802-41472824 ACTATGTGTTTAAGGAAAAGGGG + Intronic
1182201878 22:28580958-28580980 ATATTTTTCTTAAGGAAGAGAGG - Intronic
1182379602 22:29877130-29877152 ATGATTTTCTTAAGTGAAACTGG + Intergenic
1185029921 22:48436826-48436848 AGGATGATGTTAAGGAAAATAGG - Intergenic
950299549 3:11864410-11864432 ATGATGTTCATCAGGAATATTGG + Intergenic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
950728390 3:14934784-14934806 ATGATGATATAAAGTAAAAGAGG - Intergenic
953553147 3:43920449-43920471 AGGATGTGCTTAAGCAAAAGAGG - Intergenic
955151695 3:56374009-56374031 ATGATATTATAAAGGAAAACTGG - Intronic
955793817 3:62614431-62614453 ATGATTTTCTGAAGGCAGAGAGG + Intronic
956011540 3:64836927-64836949 AGCAAGTTCTTAAGGAAAAGTGG + Intergenic
956211594 3:66807176-66807198 AAGATGGTCGTAAGGCAAAGAGG - Intergenic
956258429 3:67309537-67309559 ATGATTTTTTTAATGTAAAGTGG + Intergenic
957316158 3:78579279-78579301 ATGAGGTCCTTAAGGAAATTGGG + Intergenic
958523586 3:95223612-95223634 ATGATGTTCTTCAGGGATATTGG + Intergenic
959122256 3:102246638-102246660 AGGATGTTGTTAGGGAAAAGTGG + Intronic
959648066 3:108725234-108725256 ATCATTTTCCTAAGGAATAGTGG - Intergenic
959776725 3:110173625-110173647 ATGATGTACAGCAGGAAAAGAGG + Intergenic
960742195 3:120846589-120846611 AAGATGTTCTAAATGAATAGTGG - Intergenic
961385804 3:126522698-126522720 ATGATGTTCTCAAAGGACAGGGG - Intergenic
961808531 3:129506974-129506996 ATGATGTACTGAAGGAGTAGTGG + Intronic
962214574 3:133510202-133510224 AAGATATTCTTAAGTAAAACTGG + Intergenic
962484633 3:135830596-135830618 AAGTTTTTATTAAGGAAAAGGGG + Intergenic
963308582 3:143682156-143682178 CTGATTTTCCTAAGGCAAAGAGG - Intronic
964205379 3:154168775-154168797 ACGCTGTTTTTAAAGAAAAGTGG - Intronic
965066806 3:163859536-163859558 ATGAATTTCCTAAGGGAAAGAGG + Intergenic
965083753 3:164067615-164067637 ATGATGTTCTAAGGTAAAAAAGG - Intergenic
966581475 3:181570784-181570806 AAGATATTCTTAAAGAAAAAAGG + Intergenic
967719526 3:192800542-192800564 AGGATTTTCTTAAGTAAAACTGG - Intronic
970314162 4:14813504-14813526 TTGAAGTTCTTAAGGGATAGAGG + Intergenic
971401872 4:26283576-26283598 AGGATTTTCTAAAGCAAAAGGGG + Intronic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973788295 4:54355509-54355531 ATTGTGTTCTGAAAGAAAAGTGG - Intergenic
974905372 4:68048608-68048630 TTGATAATCTTTAGGAAAAGTGG - Intergenic
974939850 4:68453625-68453647 ATAATGATCTTTGGGAAAAGAGG - Intronic
975020665 4:69483680-69483702 ATAATGTTTTTATGTAAAAGGGG - Intronic
975091035 4:70404488-70404510 ATGATGTTTTGAAGGCAGAGTGG - Intronic
975190887 4:71460727-71460749 CTGATATTCTGAAGGAGAAGGGG + Intronic
975515516 4:75243326-75243348 ATGAGGTTTTTAAGCAAAAGAGG + Intergenic
977894743 4:102350515-102350537 ATGAGGTACTTACAGAAAAGTGG - Intronic
978646813 4:110943121-110943143 ATGATTTTCTTATAGAGAAGAGG + Intergenic
978748998 4:112225952-112225974 AAGATGTTCTTAAAGATAAAAGG - Intergenic
979453608 4:120901681-120901703 ATAATGTATTTAAGTAAAAGAGG + Intronic
979615287 4:122735313-122735335 ATGAGGTTTATAAGGAAAGGTGG + Intronic
979794062 4:124822678-124822700 ATGATGTTCTGAAGAAATGGAGG - Intergenic
979939290 4:126739808-126739830 AAAATATTCTTAAGGACAAGTGG - Intergenic
980241322 4:130180325-130180347 ATGAAAGTTTTAAGGAAAAGAGG + Intergenic
980572709 4:134641895-134641917 ATAATTTTTTTAAAGAAAAGTGG - Intergenic
981270735 4:142845699-142845721 AAGAAGTCCTTAAGGAATAGAGG - Intronic
981454407 4:144937092-144937114 TTGATGTTCATAAGGAATATTGG + Intergenic
982914348 4:161186854-161186876 ATGAAGTTAATTAGGAAAAGAGG + Intergenic
984208040 4:176810680-176810702 ATGGTGTTCTTTCAGAAAAGAGG - Intergenic
984241356 4:177223915-177223937 ATGAGGCTCTCAAGAAAAAGAGG + Intergenic
984926808 4:184814341-184814363 ATGATGTTCATGATGGAAAGAGG - Intronic
987235915 5:15941489-15941511 ATGATGCTCTCAAAGAAAAAAGG - Intergenic
987547196 5:19327028-19327050 ATTATGTTTTTTAGGAAAATTGG + Intergenic
987735627 5:21839245-21839267 ATTTTGTTATTAAGGAAAACAGG - Intronic
989635483 5:43528279-43528301 ATCATGTTATGGAGGAAAAGGGG - Intronic
990035449 5:51312769-51312791 ATGATATTGTTAAGGAAGATAGG + Intergenic
990075269 5:51838245-51838267 ATGAATTTCTTATTGAAAAGGGG + Intergenic
992079280 5:73218916-73218938 AGAATGTTCTCCAGGAAAAGGGG - Intergenic
992572474 5:78073754-78073776 ATCATAATCTTAGGGAAAAGTGG + Intronic
993134868 5:83947292-83947314 CTGCTGTTCTTAAGGGATAGAGG + Intronic
993683659 5:90911206-90911228 GTGAAGTTCTTCAGGAAAAGGGG + Intronic
995010083 5:107247725-107247747 CTGATGATATTAGGGAAAAGTGG + Intergenic
996819640 5:127612297-127612319 CTGATGTTCCTTAAGAAAAGGGG - Intergenic
996981205 5:129497364-129497386 ATGATATTATTCAGTAAAAGAGG - Intronic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG + Intronic
999705295 5:154267291-154267313 ATGATGTTTTTTGGGGAAAGTGG + Intronic
999865499 5:155696210-155696232 ATGATGTTGTTATGGAGAAGAGG + Intergenic
999956919 5:156712766-156712788 ATGCTGCTCTGAAGGAAGAGGGG - Intronic
1002550439 5:179985897-179985919 ATGATTTTCTTAATGAAATCTGG + Intronic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004217274 6:13714328-13714350 ATGATATGCTAAATGAAAAGAGG + Intergenic
1004399591 6:15276082-15276104 ATAATGTTAATGAGGAAAAGAGG + Intronic
1004405230 6:15326986-15327008 TTGTTGTTCTTGAGGAAATGAGG + Intronic
1005513341 6:26531559-26531581 TTGATGTTTATAAAGAAAAGTGG + Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1008313461 6:50007856-50007878 CTGATGTTCATATGGAAAACGGG - Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008449163 6:51629615-51629637 AAGATATTCTTAAGTAAAATTGG - Intronic
1009631887 6:66210566-66210588 AGGATTTTCTTAATTAAAAGTGG + Intergenic
1010637193 6:78275224-78275246 ATAATAATCTTAAGTAAAAGTGG + Intergenic
1011727598 6:90226102-90226124 AGGATGTTCTACAGAAAAAGGGG + Intronic
1011917603 6:92527299-92527321 ATAATGATCTTAAGGAAACTAGG + Intergenic
1013313201 6:108916929-108916951 ATGATGTTCTCAAGACACAGAGG - Intronic
1013623711 6:111916880-111916902 AAGATGTTCTTAACAAAAAGAGG + Intergenic
1014383416 6:120772607-120772629 GTGATGTTCCCTAGGAAAAGAGG + Intergenic
1014649226 6:124015369-124015391 ATGATTTAGTTGAGGAAAAGAGG - Intronic
1016195046 6:141325121-141325143 AAGATGTGCTTAATGAATAGAGG - Intergenic
1016294542 6:142560834-142560856 ATGATGGGCTTAATGTAAAGTGG + Intergenic
1017346925 6:153394297-153394319 ATGATATTATTTAGGGAAAGAGG - Intergenic
1017536909 6:155356920-155356942 ATGATGCTCTTCATGGAAAGAGG + Intergenic
1017990874 6:159488874-159488896 ATGATAAGCTTCAGGAAAAGGGG - Intergenic
1017998709 6:159558632-159558654 AGGATGTACTTCAGGAAAAAGGG + Intergenic
1018092858 6:160360545-160360567 TTTATGTTCTTAAGAGAAAGAGG - Intronic
1018538102 6:164845468-164845490 AAGTTTTTCTTCAGGAAAAGGGG - Intergenic
1020496269 7:8856891-8856913 ACGATTTTCTTAAGAGAAAGGGG - Intergenic
1021109966 7:16682218-16682240 ATGATGTTTTTATGTAAATGAGG - Intronic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1024726180 7:52198506-52198528 TTGATGTTCATAATGAAAATTGG + Intergenic
1025997685 7:66538304-66538326 ATGAGTTTCTGAAGGAAATGGGG - Intergenic
1027387589 7:77673819-77673841 AGGATGTTTTTAAGAAAAAACGG + Intergenic
1027753723 7:82184403-82184425 ATCATGTTCTCTAGAAAAAGGGG - Intronic
1027857038 7:83525008-83525030 ATGATGTACTTCAGTAAAACAGG - Intronic
1028379136 7:90178389-90178411 TTCATGTTCTGAAGGGAAAGAGG + Intronic
1028801056 7:94966742-94966764 TTGATGTTCTTCAGGAATATTGG + Intronic
1029090388 7:98043525-98043547 ATGATCTCCTTTAGAAAAAGTGG + Intergenic
1030747628 7:113186977-113186999 ATGCTGTTCTAAAGTAAAAGTGG + Intergenic
1031269686 7:119632591-119632613 AAGAAGTTTTTAAAGAAAAGAGG - Intergenic
1031842375 7:126759506-126759528 ATGACATTCTTAAGGTAAATAGG - Intronic
1033007865 7:137587014-137587036 CTGATGTTCTAATGGAAGAGGGG - Intronic
1036800105 8:11784619-11784641 ATGATCTCCTTAAGGAGAGGTGG - Intronic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1038272305 8:26085191-26085213 TTGATGTTCTTGAGGACTAGTGG - Intergenic
1038871424 8:31498623-31498645 ATAATGTTGTCAATGAAAAGTGG - Intergenic
1038998888 8:32957526-32957548 GTTCTGTTATTAAGGAAAAGGGG - Intergenic
1039275339 8:35928812-35928834 ATGGTGGATTTAAGGAAAAGAGG + Intergenic
1039344000 8:36683973-36683995 AGGAAGTTCTTTAGGAAGAGTGG - Intergenic
1039459373 8:37730654-37730676 ATGATGTTTTTAAGCAGAAAAGG + Intergenic
1040608225 8:48956328-48956350 TTGATGTTCTTCAGGGATAGTGG + Intergenic
1040870928 8:52100091-52100113 GAGGTGTTCTTAAGGAAAACTGG + Intergenic
1041629823 8:60074580-60074602 CTGATTTTCTTAAGGATGAGTGG + Intergenic
1042229019 8:66538535-66538557 AAGACGTATTTAAGGAAAAGAGG - Intergenic
1042350588 8:67773225-67773247 ATGATGTTCAGAAGGTGAAGAGG - Intergenic
1042793172 8:72631490-72631512 CTGATGTTCTTATAAAAAAGGGG - Intronic
1042812783 8:72844994-72845016 GTGATCTTTTGAAGGAAAAGAGG + Intronic
1043160250 8:76838053-76838075 AAGATGATTTGAAGGAAAAGTGG + Intronic
1043681125 8:83025589-83025611 AGAATGTTCTTAAAGAAAAGAGG + Intergenic
1044420051 8:91984232-91984254 ATCATGTTCTCCAGGAAGAGAGG - Intronic
1045070829 8:98502831-98502853 TTGATGTTCATAAGGAATATTGG + Intronic
1045317329 8:101054441-101054463 GTGATGTTCTCAGGGGAAAGGGG - Intergenic
1045370805 8:101520886-101520908 AGGAATTTCTCAAGGAAAAGAGG - Intronic
1045558335 8:103236648-103236670 ATGAACTTGTTAAGGAAAACTGG - Intergenic
1045756121 8:105544589-105544611 TTGATGTTCTGAAGAAAAGGAGG + Intronic
1045836800 8:106531899-106531921 AAGATGCACTTAAGGAAAAGGGG + Intronic
1046007888 8:108508019-108508041 ATGCAATTCTTAAGGAAAAGAGG + Intergenic
1046343967 8:112897610-112897632 ATGTTACTCTTTAGGAAAAGTGG + Intronic
1046503213 8:115105590-115105612 ATGTTGCTCTCAGGGAAAAGGGG - Intergenic
1048980416 8:139700831-139700853 ATGCATTTCTTAAGGAAAACTGG + Intronic
1049051117 8:140197437-140197459 GTGACTTTCCTAAGGAAAAGGGG + Intronic
1049677160 8:143895423-143895445 ATGATTAAGTTAAGGAAAAGAGG - Intergenic
1050368201 9:4892659-4892681 ATGATATTATTAAGGATAAGGGG + Intergenic
1051356559 9:16244466-16244488 CTGAAGATCCTAAGGAAAAGAGG - Intronic
1055005355 9:71499357-71499379 ATGATGATCTCAAGGAAATTTGG + Intergenic
1055512864 9:77012422-77012444 ATGACCTTTTTAAGGAAACGAGG + Intergenic
1056085074 9:83139977-83139999 ATGATGTTCTTAATGACTGGGGG + Intergenic
1056982115 9:91323929-91323951 ATTATTTTTTTAAGGCAAAGAGG - Intronic
1057067231 9:92066713-92066735 GTGATGTTAAAAAGGAAAAGAGG + Intronic
1057304933 9:93906576-93906598 ATGGTGTTATTTAAGAAAAGGGG + Intergenic
1057341152 9:94202550-94202572 AGGACATTCTTAAGTAAAAGTGG - Intergenic
1058499287 9:105593971-105593993 AAGTTGTTCTTTGGGAAAAGAGG + Intronic
1058550392 9:106108596-106108618 ATCTTTTTCTCAAGGAAAAGTGG - Intergenic
1058604884 9:106710138-106710160 ATGATGTTATTAAATGAAAGAGG + Intergenic
1059202403 9:112430389-112430411 ACGATGTCCATAAGGAAATGGGG + Intronic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1059888639 9:118775868-118775890 ATCATGCTATTAATGAAAAGAGG - Intergenic
1060905379 9:127300141-127300163 TTGATGTTATTCAGGAAAACTGG - Intronic
1062671221 9:137710900-137710922 ATGATGTCCATTTGGAAAAGCGG + Intronic
1186066517 X:5772015-5772037 ATGATGTTATTAAGGAACTAAGG + Intergenic
1186308963 X:8296699-8296721 GTGATATTGTCAAGGAAAAGTGG - Intergenic
1186320365 X:8417655-8417677 ATAATTTTTTTAAGGAAAGGCGG + Intergenic
1187255483 X:17637965-17637987 AGGATGGTCTTCAGGAAAAGTGG + Intronic
1188348313 X:29095671-29095693 ATGATTTTCTCAAGGAATAATGG + Intronic
1188417355 X:29951932-29951954 AGGATATTTTTAAGGGAAAGTGG + Intronic
1191156281 X:57277139-57277161 ATGATGTTCATCAGGAATATTGG - Intergenic
1192966193 X:76179717-76179739 TTGATGTTCTTCAGGAATATTGG + Intergenic
1192996445 X:76517668-76517690 AATATGTTCTTAACAAAAAGAGG - Intergenic
1193416161 X:81227157-81227179 ATGATATTCTTATGAAAAAATGG + Intronic
1193749917 X:85328547-85328569 GTGATTTTCCTAAGGAAAATTGG + Intronic
1194292356 X:92089973-92089995 ATGATCATCTTGAGGAAAAATGG - Intronic
1194314573 X:92359750-92359772 ATGATGCTCTTAGGTAATAGTGG - Intronic
1194675327 X:96787394-96787416 GTGATTTTTTTAAGGTAAAGAGG + Intronic
1195791771 X:108595981-108596003 ATGTTGTTGTTCAGGAATAGGGG + Intronic
1195827479 X:109018022-109018044 GTGATGGTCTTAAGGAAAAAGGG - Intergenic
1197048108 X:122025110-122025132 ATGATTCTCTTAAGTAAAAATGG + Intergenic
1197424628 X:126280476-126280498 ATGTTATGCTTTAGGAAAAGGGG - Intergenic
1199344691 X:146724541-146724563 ATGTTGTTCTCAAGGCAAAGAGG - Intergenic
1199787965 X:151122347-151122369 TTGATGTTCATAAGGAATATTGG - Intergenic
1200609864 Y:5314599-5314621 ATGATCATCTTGAGGAAAAATGG - Intronic
1200622626 Y:5471273-5471295 ATGATGCTCTTAGGTAATAGTGG - Intronic