ID: 1004049364

View in Genome Browser
Species Human (GRCh38)
Location 6:12060058-12060080
Sequence GTGAACAATATAAACGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004049364_1004049368 10 Left 1004049364 6:12060058-12060080 CCCACCACGTTTATATTGTTCAC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1004049368 6:12060091-12060113 TTGTTCCAAGCTATTTCAATTGG 0: 1
1: 1
2: 1
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004049364 Original CRISPR GTGAACAATATAAACGTGGT GGG (reversed) Intronic
901372519 1:8811812-8811834 GGGGACAATATTAATGTGGTTGG - Intronic
908198993 1:61774534-61774556 GTGAAGAATCTAATGGTGGTAGG - Intronic
909076646 1:71056653-71056675 GTGAAGGATATAAAAGGGGTTGG - Intergenic
911575405 1:99571404-99571426 GTCAACAATTTAAATATGGTGGG - Intergenic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
921531946 1:216293803-216293825 CTGAAAAAAATAAACGTGATCGG + Intronic
922167091 1:223125170-223125192 GGGAACAATATTAATGTGTTAGG - Intronic
1063215283 10:3919638-3919660 GTGAACTATAAAAAAGTGCTTGG + Intergenic
1064879681 10:20036711-20036733 ATGCACAATATAATTGTGGTGGG - Intronic
1066192317 10:33067327-33067349 GTGACCATTAAAAACATGGTGGG - Intergenic
1071365020 10:84890680-84890702 GTGAAAAATATAAATGTGCAGGG + Intergenic
1072027677 10:91477335-91477357 GTGAACTATAGAAATGTTGTGGG + Intronic
1076020836 10:127071373-127071395 GTGCACAGTATAAATGTGGGTGG - Intronic
1079428830 11:20369094-20369116 GTGTACAATATAAAGTTGGGAGG + Intronic
1081163141 11:39776157-39776179 GTGAAAAATATAAAAATGGAAGG + Intergenic
1082120685 11:48376667-48376689 GTAGACAGTAGAAACGTGGTTGG + Intergenic
1087970293 11:104472816-104472838 GTGAAGAATATAAACTACGTAGG - Intergenic
1088104272 11:106188072-106188094 TTGTACAATTTAAACGTGATTGG + Intergenic
1092459930 12:8677426-8677448 TTGAACAATATTAAGGAGGTAGG - Intergenic
1096171334 12:49473116-49473138 GGGAACAATAGAAACTTGGCTGG + Intronic
1096934628 12:55257903-55257925 ATGATCAAGATAAAAGTGGTTGG + Intergenic
1101027117 12:100620945-100620967 GTGAACAAGATAAACTTGATTGG + Intronic
1103770141 12:123316089-123316111 GTAAAAAATATATATGTGGTGGG - Intronic
1115639861 14:35327507-35327529 GTCAACAATGTAAACAAGGTGGG + Intergenic
1116427034 14:44803712-44803734 GTGAAAAAGAGAAATGTGGTTGG + Intergenic
1118500728 14:66360100-66360122 GTGAACATTATAAACATAGTTGG - Intergenic
1121435014 14:93913440-93913462 GAAAACAATAGAAACGTGATAGG + Intergenic
1122017760 14:98810637-98810659 ATGAACAAAATAAGAGTGGTAGG - Intergenic
1128405431 15:67332640-67332662 GTGAACATTATAAATCTGGATGG + Intronic
1133083446 16:3342581-3342603 CTGAACAATAAAAACGAGGCCGG + Intergenic
1138509349 16:57499028-57499050 GTGTACGGTATAAACATGGTTGG - Intergenic
1142700470 17:1656847-1656869 GTGTTCAATAGAAACGTAGTTGG - Intronic
1144330460 17:14219127-14219149 GGGAACCACATCAACGTGGTGGG + Intergenic
1145409397 17:22644433-22644455 GTGAACATTATAAACATCTTTGG + Intergenic
1150024067 17:61653274-61653296 GTGAACAATGTAAACAGAGTTGG + Intergenic
1153855575 18:9142488-9142510 GTGTACAATATGAATTTGGTGGG - Intronic
1155920772 18:31600891-31600913 GTGACCAATACAATCATGGTAGG - Intergenic
1157972343 18:52285017-52285039 ATCAACAATATTAACATGGTAGG + Intergenic
1158300593 18:56047815-56047837 TTGAAAAATATAAACATGGAAGG + Intergenic
1161870047 19:6863020-6863042 CTCAACAATATGAACGTGTTTGG - Intergenic
1168239243 19:55081102-55081124 GTGAACAAGTTCAACGAGGTAGG - Intronic
927823220 2:26287678-26287700 GTGAGCAATACCAACATGGTTGG + Intronic
931069813 2:58633174-58633196 GTGAAAAATTAAAAGGTGGTTGG + Intergenic
931127106 2:59290328-59290350 CTGCAGAATATAAACGTAGTTGG - Intergenic
931140005 2:59447142-59447164 CTGAACAAAATAGACGTGGAAGG + Intergenic
941212676 2:162661430-162661452 GTGAAAAAAATAAATATGGTTGG + Intronic
942891368 2:180992960-180992982 ATGAAATATATAAATGTGGTAGG - Intronic
943997931 2:194795946-194795968 GTGAAGAATATAGACCTGGTGGG + Intergenic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1181613832 22:24038058-24038080 GTGAACAACATCAAGGTGCTGGG - Intronic
1183992271 22:41605532-41605554 GTGAGCAAGATAACCATGGTAGG + Intronic
957339692 3:78879653-78879675 AAGAACAATAAAAACGTAGTCGG + Intronic
957543815 3:81610851-81610873 GTTAAAAACATAAAAGTGGTTGG + Intronic
957597230 3:82283021-82283043 GTGAACAGTATAAACTTCCTGGG + Intergenic
959731076 3:109603219-109603241 GGGAACATTTTTAACGTGGTGGG + Intergenic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
965997243 3:174898961-174898983 GTGCACAAAATAAACATGTTCGG - Intronic
969789957 4:9486608-9486630 GTGGAAAGTATAAAGGTGGTTGG + Intergenic
975831298 4:78372027-78372049 GGGGGCAATATAAAGGTGGTAGG - Intronic
976444630 4:85116663-85116685 GTGAATAGCAAAAACGTGGTGGG - Intergenic
980003712 4:127517371-127517393 GTAAACAATAGCAACGTGGATGG + Intergenic
984494449 4:180477078-180477100 GTGTACAATATAAAAGTTATAGG + Intergenic
986351856 5:6887546-6887568 ATGAACAATATGAACATGATAGG + Intergenic
991970101 5:72132672-72132694 GAGAACAATAAAAACAGGGTGGG - Intronic
994412042 5:99418895-99418917 GGAAACAAAATAAAAGTGGTTGG - Intergenic
994481782 5:100346365-100346387 GGAAACAAAATAAAAGTGGTTGG + Intergenic
998986826 5:147767593-147767615 GAGAAAAATATAAACCTGGAGGG - Intronic
998987739 5:147780761-147780783 GTGAAAATTATAAATGTGGGGGG + Intronic
999002444 5:147939311-147939333 GAGAATAATATAAGCCTGGTTGG - Intergenic
1001013725 5:168121898-168121920 TGGAACAATATAAACATGATGGG + Intronic
1003867702 6:10378644-10378666 GTGAACAATATAGACTAGATGGG + Intergenic
1004049364 6:12060058-12060080 GTGAACAATATAAACGTGGTGGG - Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006938238 6:37733316-37733338 ATGAACAAAATAACTGTGGTAGG - Intergenic
1008807355 6:55447258-55447280 GTGAACATAATATACGTGATAGG + Intronic
1008873376 6:56299505-56299527 GTGCACATTATTAAGGTGGTTGG - Intronic
1013880728 6:114896355-114896377 AGGAACAATATAAATGTGATTGG - Intergenic
1018355959 6:163017239-163017261 GTGATAAATATAAACGTGGGGGG + Intronic
1022176613 7:27877133-27877155 CGGAAGAAAATAAACGTGGTCGG - Intronic
1030109173 7:106011908-106011930 ATGAATAATATAAAGGTGTTAGG + Intronic
1030506811 7:110434940-110434962 GTACACAATATAAACTGGGTGGG + Intergenic
1031518993 7:122739540-122739562 GTGAACTATATCAACTTTGTTGG - Intronic
1032914971 7:136479570-136479592 GTGGACATTCTAAATGTGGTAGG - Intergenic
1046218304 8:111179290-111179312 GAGAGCAATATAAAGTTGGTAGG + Intergenic
1048163853 8:132044755-132044777 GTGAACTATAAATACCTGGTAGG + Intronic
1048822093 8:138390040-138390062 GTGAACAAGATAAACAAGGTTGG - Intronic
1050978666 9:11978080-11978102 GAGAAAAATAAAAACATGGTTGG - Intergenic
1059599751 9:115764185-115764207 TTGAACAATATATACGGGGATGG - Intergenic
1189517104 X:41724249-41724271 CTGAACAATATAACCTTAGTTGG + Exonic
1189986521 X:46558221-46558243 GTGAATAATGTAAACTTGTTGGG + Intergenic
1192733569 X:73826612-73826634 GTAAACAATAGAAAAGAGGTAGG + Intergenic