ID: 1004054040

View in Genome Browser
Species Human (GRCh38)
Location 6:12116487-12116509
Sequence AGATGCAAACAGAAGGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004054040 Original CRISPR AGATGCAAACAGAAGGACGA TGG (reversed) Intronic
901143793 1:7052129-7052151 AGATGCAGACTCAAGGACAAGGG - Intronic
901594601 1:10374932-10374954 AGATGAAGACATAAGGCCGACGG - Exonic
903530378 1:24025748-24025770 AGAGGCAAACAGAAGAAGGATGG - Intergenic
907108506 1:51905650-51905672 AGATTCAGACAGAGGGACAAAGG - Intergenic
910129457 1:83886354-83886376 AGAGGAAAAGAGAAGGACAAGGG - Intronic
912245026 1:107952869-107952891 AGAAGCAAACAGAAAGTAGAGGG + Intronic
914444140 1:147735450-147735472 AGATGGAAACAGAAGCAGAATGG + Intergenic
916300593 1:163269331-163269353 AGCTGCAAACAGAAGGTCAATGG + Intronic
919213888 1:194525771-194525793 AGACGCAGACAGCAGGAAGATGG - Intergenic
919646530 1:200100285-200100307 AGATGCTAAATGAAGTACGAAGG - Intronic
920438815 1:205965134-205965156 TGCTGCAAACAGAAGCACAAAGG + Intergenic
921511109 1:216031875-216031897 ACAGGCAAACATAAGGACCATGG - Intronic
924516668 1:244771714-244771736 AGATGCAAACAGGAGCCAGATGG + Intergenic
924828736 1:247570321-247570343 AAATGCAAACAGAAGAAAGCGGG - Intronic
1063289984 10:4735195-4735217 AGCTGCAAACTGAAAGAGGAAGG - Intergenic
1064982876 10:21181776-21181798 AGATGCCAAGAGAAGCAGGAGGG - Intergenic
1065336930 10:24662306-24662328 AGATGTTAACAGAAGTAAGAGGG + Intronic
1066435282 10:35391864-35391886 AGATAAAAACAAAAGGAAGAGGG - Intronic
1066794931 10:39109418-39109440 AGATACAAAAAGAAAGACTAAGG + Intergenic
1067945117 10:50684357-50684379 ACCTGGAAACAGAAGGAAGAAGG - Intergenic
1068868646 10:61920622-61920644 AGATGGAAAAAAAAGGAAGATGG + Intronic
1070866622 10:79711229-79711251 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1070880411 10:79849350-79849372 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071633534 10:87233452-87233474 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071646981 10:87365668-87365690 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1073274768 10:102300751-102300773 AGAAGCAAACTGAATGACGACGG - Intronic
1073592691 10:104771808-104771830 AGATACAATGAGAAGGACGATGG + Intronic
1078613380 11:12841628-12841650 GGGTGCAAACTGAAGGAAGATGG - Intronic
1079265609 11:18929272-18929294 GGATGCAAACACAAGGAAGGAGG - Intergenic
1083143335 11:60739412-60739434 AGATGCAAAGAGAAGGATTCAGG + Intronic
1083187063 11:61023898-61023920 AGCAGCAAACAGAAAGACAAGGG + Intergenic
1084061302 11:66677271-66677293 ACATGCAAACAGGAGGTCGAGGG + Exonic
1085113343 11:73908079-73908101 AGTTGTAAACAGAAGGACCTAGG + Intronic
1085816133 11:79739198-79739220 AGATGAAATGAGAAGGAGGAGGG - Intergenic
1086322576 11:85665422-85665444 AGATGCACACTGAAGTACGCAGG - Intronic
1086685140 11:89725006-89725028 ATAGGCAAACAGAATGACAAAGG - Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1087759917 11:102094412-102094434 AGATGAAAACAAAAGAACAAAGG + Intergenic
1088080580 11:105906921-105906943 AAATGCTAACAGATGGACAAAGG + Intronic
1089431363 11:118427364-118427386 AGCTGCAAAAAGAAGGAGAAGGG - Intronic
1089853046 11:121516719-121516741 AGAACCAAACAGAAGGAGGTAGG - Intronic
1090836139 11:130455516-130455538 AGGTGCAAACAGAAGTGCAAGGG + Intronic
1092322912 12:7497481-7497503 GGAGGCAAACTGAAGGATGAGGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1096472055 12:51885225-51885247 AAATGCAAACAGAAGTCTGATGG - Intergenic
1097803582 12:63941261-63941283 TTATTCAAACAGAAGGACAAGGG - Intronic
1097992944 12:65855507-65855529 AGATGCAAACACTAGGCAGATGG + Intronic
1098186047 12:67897317-67897339 AGAGGCAAAAAGCAGGAAGAGGG + Intergenic
1099876513 12:88413653-88413675 AGATGAAAACCAAAGGACAATGG + Intergenic
1100895044 12:99172086-99172108 TGAGGCAAAAAGAAGGAAGATGG + Intronic
1101843149 12:108342106-108342128 AGATGAAAAGAGGAGGAGGAAGG + Intergenic
1103152050 12:118649288-118649310 AAATTCAAACAAAAGGAAGAGGG - Intergenic
1103526625 12:121573566-121573588 AGAAGTAAACAGTAGGCCGAGGG - Intronic
1104998711 12:132674907-132674929 AAATGCCAACAGAAGGAGGCTGG - Intronic
1107156556 13:37173858-37173880 AGATGCTAACAGAAGAGAGAAGG - Intergenic
1110033723 13:70653132-70653154 AGAAGAAGACAGAAAGACGAGGG + Intergenic
1110338294 13:74358478-74358500 AGATGCATACTGAAGTACGTAGG - Intergenic
1111958559 13:94784129-94784151 AGATGCACACAGAGGGAAGAAGG + Intergenic
1116897514 14:50331558-50331580 AGCTGCAAAGAGAAAGACTAAGG + Exonic
1119836917 14:77758968-77758990 AGATGCCAACAGTAGGTCCAAGG + Intronic
1120316339 14:82898320-82898342 GGATGCATAGAGAAGGAGGAAGG - Intergenic
1122765611 14:104067496-104067518 AGAAGAAAACAGAAAGATGAGGG - Intergenic
1125153906 15:36564501-36564523 AGATGCTATCAGAAGGAACAAGG + Intergenic
1125407337 15:39367014-39367036 AGATGCAAACAGAAAGACTGGGG + Intergenic
1125702786 15:41703091-41703113 AGATGCAAAAAAAAGGACATTGG - Intronic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1127554899 15:60078258-60078280 AGATGCAGACAGCAGGGGGACGG - Intergenic
1128700906 15:69803571-69803593 AGAGGCACAGAGAAGGACGGTGG - Intergenic
1129640522 15:77372466-77372488 AGATTCAAACAGATTGAGGATGG - Intronic
1130830925 15:87598005-87598027 AGATGCAAGGAGATGGAAGAAGG + Intergenic
1131476881 15:92747327-92747349 AGATGCAGAGAGAAGGATGGAGG - Intronic
1131553549 15:93377892-93377914 AGAGGATAACAGAAGGACCAGGG + Intergenic
1131987667 15:98061386-98061408 AGAAGAAGACAGAAGGATGAGGG - Intergenic
1133135785 16:3710749-3710771 AGAAGAAGACAGAAGGACGTGGG - Intronic
1133770096 16:8862838-8862860 AGATGCAAGGAGGACGACGATGG - Intronic
1134336287 16:13302596-13302618 AGATGCCAAAAGAAGGAAGCAGG - Intergenic
1134711204 16:16327591-16327613 AGGTGCAGGCAGAAGGAAGAGGG - Intergenic
1134948370 16:18340992-18341014 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1134955625 16:18381102-18381124 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1135888357 16:26334310-26334332 AGATGCAATGAAAAGGACCACGG - Intergenic
1136060889 16:27725706-27725728 AAAGGCAAACAGATGGACCATGG - Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1137562173 16:49509980-49510002 AGAGGCAAGGTGAAGGACGATGG - Intronic
1138368727 16:56506497-56506519 ACATGAAAACTGAAGGACTAAGG + Intronic
1139679346 16:68548905-68548927 AGAGGCAAACAGAAAAACGATGG - Intronic
1140742726 16:77955783-77955805 AGATGCATATAGAAGTACAAAGG + Intronic
1141171611 16:81695184-81695206 AGAGGCAAACAGGAGAACAAGGG - Intronic
1144577038 17:16435856-16435878 AGATGCAAAGAGAAGGTGAAGGG - Intronic
1147497339 17:40929244-40929266 AGAGGCAAACAGCAGAAAGAAGG + Intronic
1148438998 17:47702210-47702232 AGGTGGAAACAGAAGAAAGAGGG - Intronic
1148559823 17:48599536-48599558 AGATACAGACAGAAGGGAGAGGG - Intronic
1149340271 17:55678635-55678657 AGATACAAACAGAGGGATAAAGG + Intergenic
1151169455 17:72234771-72234793 AGGAGAAAACACAAGGACGAAGG + Intergenic
1151352752 17:73541373-73541395 AGATGACATCAGAAGGACCAAGG + Intronic
1151450302 17:74194668-74194690 AGAAGAAAACAGAAGAAAGAAGG + Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1155034594 18:22015296-22015318 AGATGGAAACAGAAAGTCAAAGG - Intergenic
1155949675 18:31897135-31897157 AGATGAATACTGAAGAACGAAGG - Intronic
1156783322 18:40878703-40878725 AAATGCAAACAGATGTAGGAGGG - Intergenic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159277764 18:66243268-66243290 AGATGCAAACAGAAAGTAGAAGG - Intergenic
1159695521 18:71552405-71552427 AGAAGGAAACAGAAAGATGATGG + Intergenic
1160128247 18:76199295-76199317 AGAAACAAAAAGAAGGACTAAGG + Intergenic
1160591200 18:79945566-79945588 AGAGGCAAACAGAAGAAGGGAGG + Intronic
1160676893 19:395759-395781 GGATGAATAGAGAAGGACGATGG + Intergenic
1161586352 19:5107879-5107901 AGAAGCAAACAGCAGGAAGGAGG - Intronic
1162008662 19:7797323-7797345 AGATGCAAAAAGAAAGACTAAGG - Intergenic
1162433143 19:10641478-10641500 AGCTGAAAGCAGAAGGTCGATGG + Intronic
1163923333 19:20313882-20313904 AAATGCACACAGAACGATGAGGG + Intergenic
1164428004 19:28160732-28160754 AGAAGCAAACAGAAGTCAGAAGG + Intergenic
1164506927 19:28868700-28868722 AGATTAAAACAGCAGGAGGAAGG + Intergenic
1165163736 19:33834979-33835001 AGATGGTAACAGAAGGAGGTTGG + Intergenic
1166212740 19:41317746-41317768 GGATGAAAACAGAAGGAAGATGG + Intronic
1168087840 19:54061500-54061522 AGAGACACACAGAAGGAAGACGG + Intronic
926895499 2:17682984-17683006 AGAGGCAAATGGAAGGACTAGGG + Intronic
927228338 2:20793489-20793511 AGATGCAAAGGGAAGAACCAAGG - Intronic
928360768 2:30660534-30660556 ATATGCAAACAGCAGGAAGGTGG + Intergenic
929226297 2:39514826-39514848 TGGTCCAAACAGAAGGACCAGGG - Intergenic
929232222 2:39571540-39571562 AGATGTAAAAAGAATGATGAGGG - Intergenic
931098327 2:58967383-58967405 AGAAGAAAACACAAGGAAGATGG - Intergenic
932469291 2:71943468-71943490 AGATGGAGAGAGAAGGAAGAAGG - Intergenic
935682385 2:105649039-105649061 AGATGCATACAGGAGGGAGATGG - Intergenic
936242012 2:110795963-110795985 AGTTGCAATCATAATGACGAGGG + Intronic
937191795 2:120109145-120109167 AGATGCATACAACAGGAAGAGGG - Intronic
938313282 2:130308786-130308808 AGAAGGAAAGAGAAGGAGGAGGG + Intergenic
941995601 2:171599304-171599326 AAATGCAAACAAAACCACGATGG - Intergenic
942542053 2:177024785-177024807 AGAGGCAAACAGAAGCAAGGAGG - Intergenic
945180547 2:207087014-207087036 AGATGGAAATAGAAGGAAGATGG + Intronic
945968149 2:216210104-216210126 AGAGGAAAGCAGAAGGAAGATGG + Intergenic
946756713 2:222954383-222954405 GGACCCAAACAGAAGGAGGAGGG - Intergenic
946974520 2:225133418-225133440 AAATGCAAAAAGAAGGGCTAAGG + Intergenic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947953633 2:234169447-234169469 AGAGGCACACAGAGGGAAGATGG - Intergenic
948768683 2:240236365-240236387 AGGTGCAAACAGGAGGACGATGG - Intergenic
948834084 2:240616185-240616207 AGAGGCAAACAGAAGGAAAAAGG - Intronic
1169780726 20:9307082-9307104 AGTTCCACACAGAAGGAGGAGGG + Intronic
1169838852 20:9911667-9911689 ACTTACAAACAGAAGCACGAGGG - Intergenic
1170487404 20:16832767-16832789 AGATGCAAGCTGAAGGAGGAGGG - Intergenic
1172387168 20:34542177-34542199 AAATTCAAGCAGAAGGACGGAGG - Intergenic
1173757234 20:45527413-45527435 AGATGCAGAGAGTAGGATGATGG - Intergenic
1175665192 20:60852758-60852780 AAATGCCAACAGAAGGACACAGG + Intergenic
1175666495 20:60864614-60864636 AGATGCCAACAGAAGAAAAAGGG + Intergenic
1175680013 20:60979340-60979362 AGCTGCAATCAGAAGGAGGCAGG - Intergenic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1181868249 22:25876378-25876400 AGATGCAAACAGGAGGAGCAGGG - Intronic
1182042360 22:27248378-27248400 TGATGCAAAAATAAGGATGAGGG + Intergenic
1183405324 22:37627720-37627742 AGAGGAAAACAGAAGGAAGCTGG - Intronic
1184546248 22:45170517-45170539 AGATTCCAAAAGAAGGAAGATGG - Intronic
1185002494 22:48254413-48254435 ATATGCACAAAGAAGGAAGAGGG + Intergenic
949336993 3:2985801-2985823 AAATACAAACAGAAGGCAGAAGG + Intronic
949519105 3:4833624-4833646 AGAGGGAAACAGAAGGAAGCAGG - Intronic
951989407 3:28659252-28659274 AGATGCAAAAAGAAGTATGTTGG - Intergenic
952165130 3:30739561-30739583 AGATGCAAAGAGAAGGTATAGGG - Intronic
952521586 3:34164231-34164253 AGATGAACAAAGAAGGAAGAGGG - Intergenic
953861062 3:46544506-46544528 AGATACAAAGAGATGGACGGAGG + Intronic
955222679 3:57036384-57036406 AGAGGCAAAGAGAAAGACAAGGG + Intronic
956813756 3:72889132-72889154 AGTATCAAACAGAAGGTCGAAGG - Intronic
959118295 3:102204249-102204271 AAATGCAATCAGAAGGAAAAAGG - Intronic
959642103 3:108652371-108652393 AGATGTAAACTGAAGAATGAAGG - Intronic
959933884 3:112010579-112010601 AGAAGCAGACAGAAGGGAGAAGG - Intronic
961185915 3:124914981-124915003 AGGAGCAAAAAGAAGGATGAGGG + Intronic
961564116 3:127751234-127751256 AGGTGCAAATGGAAGGAGGAGGG - Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
962564437 3:136642931-136642953 AGAGGCACACAGAGGGAAGATGG - Intronic
963157631 3:142116397-142116419 AGATGCAGACAGAGGGAAGAAGG + Intronic
965476542 3:169162448-169162470 AGATTCAAACAGAAGGGAGATGG + Intronic
967527259 3:190509137-190509159 AGATGCAATAAAAAGGAAGAGGG + Intergenic
967530184 3:190540304-190540326 AGAAAAAAACAGAAGGACAAAGG - Intronic
968051249 3:195656483-195656505 ACATGCAGACTGAAGGAGGAAGG + Intergenic
968104575 3:195991856-195991878 ACATGCAGACTGAAGGAGGAAGG - Intergenic
968302866 3:197629439-197629461 ACATGCAGACTGAAGGAGGAAGG - Intergenic
968664320 4:1812641-1812663 AAATGCACACAGAACGATGAGGG + Exonic
968811488 4:2801425-2801447 AGAGGCAAAAAGAAGGAAGAAGG - Intronic
969122809 4:4922346-4922368 AGAAGGAAATAGAAGGAAGAGGG - Intergenic
970669459 4:18379437-18379459 AGATGTAAACTGAAAGAAGAGGG - Intergenic
971870743 4:32235348-32235370 ACATGCAAACAGAAGTTAGAAGG + Intergenic
972083088 4:35178667-35178689 ATAAAAAAACAGAAGGACGACGG + Intergenic
972970462 4:44568649-44568671 AGCTGTAAACAGAAGCACTAGGG - Intergenic
974393749 4:61308255-61308277 AGAAGCAAACACCAGGAGGAGGG + Intronic
975336142 4:73177543-73177565 AAATGCAAAAAGAGGGAGGAAGG + Intronic
976348986 4:84039121-84039143 AGAAGCAGACAGCAGGATGATGG + Intergenic
976704320 4:88006012-88006034 AGACGCATACAGAGGGAAGAGGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
979129549 4:117024726-117024748 AGTTCCAAACAGATGGATGAAGG - Intergenic
980448734 4:132944239-132944261 AGAGGCAGACAGAAAGATGAGGG - Intergenic
980462111 4:133127618-133127640 AGATGTAAACAGAATGGTGATGG + Intergenic
981674415 4:147324596-147324618 AGATGCAGACAGTAAGACAAAGG - Intergenic
982224284 4:153152124-153152146 AGATTCAAAGAGATTGACGAGGG - Intergenic
985033393 4:185814615-185814637 AGATACAAGAAGAAGGATGAAGG - Intronic
986938700 5:12922175-12922197 AGATGCAAACACTAGGTCAAAGG + Intergenic
987367793 5:17164833-17164855 ACATTGAAACAGAAGGATGATGG + Intronic
988427828 5:31084297-31084319 GCATACAAACAGAAGGAAGAAGG + Intergenic
989290594 5:39760634-39760656 AGAGGTAAACAGAAGGAAGTGGG + Intergenic
989756219 5:44958781-44958803 AGAAGGAAAAAGAAGGAGGAAGG - Intergenic
993652415 5:90537800-90537822 ACATGCAAAAAGAAGGAGGTAGG + Intronic
994459587 5:100054922-100054944 AGATGCGAGCAGAAGGAAGGAGG + Intergenic
997037089 5:130205833-130205855 AGATGGAATGAGAAGGAGGAGGG - Intergenic
998038343 5:138935326-138935348 ATATGCTGACAGAAGGACGCAGG - Intergenic
1002062712 5:176635747-176635769 TGATGCAGACAGCAGGAAGAGGG + Intronic
1002066657 5:176655222-176655244 AGATGGAAACAGCAGGACCCTGG + Intronic
1002811633 6:636756-636778 AGATGCATTCAGAATGAGGAAGG - Intronic
1003379775 6:5613917-5613939 AGCTGAGAACAGAAGGATGATGG + Intronic
1003757617 6:9139541-9139563 ATATGCAAATACAAGAACGACGG - Intergenic
1004054040 6:12116487-12116509 AGATGCAAACAGAAGGACGATGG - Intronic
1004089597 6:12487561-12487583 AGATGCAGACAGAAGCAAGCTGG + Intergenic
1004202165 6:13558886-13558908 AGATGCAGACAGCAGGCCGCAGG + Intergenic
1005228612 6:23672495-23672517 AGAAGAAAACAGAAAGATGAGGG - Intergenic
1005764640 6:28998908-28998930 ATATACAAACAGAAGGATCAGGG - Intronic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1008028154 6:46662453-46662475 AGATGCAAATGGAAGGAAAAAGG + Exonic
1008041652 6:46807720-46807742 AGAGGAAAACAGAAGAAGGAGGG + Intronic
1008424141 6:51337351-51337373 AGATGAAGACAGAAGGAGGCTGG - Intergenic
1010066517 6:71688179-71688201 AGATGAGAACATAAGGACTAAGG - Intergenic
1010363589 6:75023802-75023824 ACATGCAAAAAGAAGGACTAGGG + Intergenic
1011418802 6:87151603-87151625 AGATGCAAAGAGAAAGAGCATGG - Intergenic
1011938895 6:92817818-92817840 AGATGCCAACAGAAGCATTAAGG + Intergenic
1012497919 6:99855319-99855341 AGAAGCAACCAGCAGGATGAAGG + Intergenic
1013533376 6:111040726-111040748 AAATGAAAAAAGAAGGAGGAAGG + Intergenic
1014082803 6:117307104-117307126 AAATGCAACTAGAAGGAGGAAGG - Intronic
1014546041 6:122736815-122736837 AGATCCAGACAGATGGCCGAGGG - Intergenic
1016897051 6:149063705-149063727 AGAAACCATCAGAAGGACGAGGG - Intronic
1017568925 6:155721086-155721108 AGATGGAAACTCAAGGAAGAGGG + Intergenic
1017829187 6:158109870-158109892 ACATGCTAATAGAAGGAAGAAGG + Exonic
1018093375 6:160363854-160363876 AGATGCAAGCAGAAGAAAGTGGG - Intronic
1018164702 6:161082287-161082309 AAATGCAAACAGAAGGAATTAGG - Intronic
1018222604 6:161596015-161596037 AGATCCACACAGAAGGACAGGGG + Intronic
1023713785 7:43022305-43022327 ACAGGCAAACAGAAGGATGGGGG + Intergenic
1024356800 7:48421913-48421935 AGCTGCACACAGGAGGACTAAGG - Intronic
1024818503 7:53299322-53299344 ACATTCAAACATAAGGAAGAAGG + Intergenic
1026099959 7:67376567-67376589 AGAGGCAGAGAGAAGGATGATGG + Intergenic
1026329855 7:69342410-69342432 AGTTGTAAACAGCAGGATGAAGG - Intergenic
1028007954 7:85601408-85601430 AGAGGCAAAGAGAAGGAAAAAGG + Intergenic
1030832417 7:114241987-114242009 AGAGGCAAACAGAAGTCCAAAGG - Intronic
1031077017 7:117222733-117222755 AGTTTCAAACAGAAGGAATAAGG + Intronic
1031407902 7:121407388-121407410 AGATGGAAAGAGAAAGACCATGG + Intergenic
1033966771 7:146984596-146984618 AGATGATAACAGAAGTAAGAGGG + Intronic
1035819551 8:2577281-2577303 TGAGGCAAACAGGAGGCCGACGG + Intergenic
1036074794 8:5484483-5484505 AGCTGCCAACAGTAGGACTAAGG - Intergenic
1038163283 8:25061052-25061074 AGATGCATCCAGAAGGCAGAGGG - Intergenic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1042483751 8:69330112-69330134 ACATGCAGACTGAAGGAGGAAGG + Intergenic
1044947124 8:97399711-97399733 AGATGCAAACATGAGTAAGAAGG - Intergenic
1045290596 8:100829315-100829337 AGATGAAAACCAAAGGACAAGGG + Intergenic
1046005002 8:108468666-108468688 AGATGCAGACAGAAGTAAAATGG - Intronic
1046615085 8:116467935-116467957 AGATGAAAACCAAAGGAAGAGGG + Intergenic
1046661768 8:116955328-116955350 GGATGCAAACAGTGGGAAGATGG + Intronic
1046798839 8:118402388-118402410 AGATGCAAAGAAAAGGCAGATGG + Intronic
1048072515 8:131037651-131037673 AGAAGGAAAAAGAAGGAGGAAGG + Intronic
1048453554 8:134555941-134555963 AGATACAAAAAGAAGGAAGGAGG + Intronic
1050415069 9:5408202-5408224 AGAGGAAGACAGAAGGATGACGG + Intronic
1052085482 9:24260489-24260511 AGTGGCAGACAGAAGAACGACGG + Intergenic
1055116608 9:72612010-72612032 AAATCCAAACAGAAGCAGGAGGG - Intronic
1056227764 9:84512992-84513014 AGATGCCAACAGAAGAAAGAGGG + Intergenic
1057353825 9:94319728-94319750 ACCTGGAAACAGAAGGAAGAAGG + Exonic
1057653926 9:96937864-96937886 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1060273930 9:122167935-122167957 CGATGAAAGCAGAGGGACGAAGG - Intronic
1061052990 9:128206977-128206999 AGCTGCAACCAGAAGGAGAATGG + Intronic
1062656689 9:137607254-137607276 GGATGGGAACAGAAGGACCATGG + Intronic
1186785127 X:12949967-12949989 AGATGCTAACAGATGCACGCTGG - Intergenic
1188500554 X:30821138-30821160 AGAAGCAAAGAGAAGAACGTTGG + Intergenic
1191738087 X:64408269-64408291 AGAAGAAAACAGAAAGATGAGGG - Intergenic
1191821798 X:65318366-65318388 AGAAGGAAAAAGAAGGAAGAAGG - Intergenic
1194143022 X:90228621-90228643 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1194568684 X:95525194-95525216 AGATGGAAACAAAAGAAAGAAGG + Intergenic
1195773815 X:108381004-108381026 AGATGCAAATAGAACCATGAAGG - Intronic
1197127100 X:122959545-122959567 AGATGCACACAGAAGGAAGATGG + Intergenic
1197851624 X:130867926-130867948 TGATGCATACTGAAGGACAATGG - Intronic
1198183549 X:134233147-134233169 AGACACACACAGAAGGAGGATGG + Intergenic
1198728970 X:139707088-139707110 AGATGAAAAAAGAAGGATGGAGG + Intronic
1198896335 X:141459744-141459766 AGATGAAAAAAGAAGAAGGAAGG + Intergenic
1199057138 X:143310062-143310084 AGAAGCAAATAGTAGGATGATGG - Intergenic
1200488775 Y:3797940-3797962 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic