ID: 1004057207

View in Genome Browser
Species Human (GRCh38)
Location 6:12151831-12151853
Sequence AGCTGCATGTGGCTCTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004057207 Original CRISPR AGCTGCATGTGGCTCTCCAC TGG (reversed) Intronic
900850610 1:5139682-5139704 ATCTCCATGTTGCTCCCCACTGG - Intergenic
905141717 1:35851278-35851300 AGCTGCTTGTGGTTCTCCCATGG + Intronic
906407823 1:45556057-45556079 AGCTGCATGGGCCTCTCCTCTGG - Intronic
908511085 1:64850499-64850521 GGCAGGAGGTGGCTCTCCACAGG - Intronic
910509679 1:87989673-87989695 AGCTCTCTGTGCCTCTCCACTGG + Intergenic
912758547 1:112345836-112345858 ACCCACATGTGGCTCTCCATGGG + Intergenic
913131327 1:115839892-115839914 AGCTGCATGTGACTCCCTACGGG + Exonic
915601639 1:156926380-156926402 GGCTGCCTGGGCCTCTCCACAGG + Intronic
919112936 1:193242325-193242347 AGGGTCATGTGGCTCTCCCCTGG + Intronic
922461874 1:225819501-225819523 AGGTTCCTGTGGCTCTCCCCTGG - Intronic
1065755270 10:28925017-28925039 GGGTGCATGTGGCTCTCCAGTGG - Intergenic
1066087017 10:31981043-31981065 ACTTACATGTGCCTCTCCACAGG - Intergenic
1066632403 10:37469897-37469919 AGCTGCCTGTGGTCCTCCATGGG + Intergenic
1072718757 10:97768176-97768198 AGCAGCATGTGGGGCTCCCCAGG + Intronic
1073984579 10:109193613-109193635 GGATGCATGTGGCTCTCAGCGGG + Intergenic
1077446237 11:2592292-2592314 ACCTGCCTGTGCCTCTCGACAGG - Intronic
1077500014 11:2905119-2905141 AGCTCCCTTCGGCTCTCCACTGG - Intronic
1078358709 11:10652043-10652065 GGCTGCCTGTGGCTCTCCGGGGG + Exonic
1079173259 11:18116060-18116082 AGCAGGATGAAGCTCTCCACTGG - Intronic
1083932301 11:65852723-65852745 AGCTGCTGGTGGCTCTCGGCGGG - Exonic
1087212166 11:95455590-95455612 AGCAGCCTGTGCTTCTCCACAGG - Intergenic
1087218072 11:95516373-95516395 AGCTGCATGCTGCTGTCCACCGG + Intergenic
1087371805 11:97293791-97293813 AAGTGCAAGTGCCTCTCCACTGG + Intergenic
1090404269 11:126467676-126467698 AGCTGCTTGGGGCTCCCCATGGG + Intronic
1091186916 11:133655563-133655585 GGGAGCATGTGGCTCTCAACAGG - Intergenic
1091402811 12:190935-190957 GGGTGCCTGTGGCTCTCCAGAGG + Exonic
1094048736 12:26196031-26196053 AGCTGCATGTGCCCTTCCCCGGG + Intronic
1099689144 12:85927966-85927988 AGCAGCCTGAGGCTCTCCCCAGG + Intergenic
1099807602 12:87540051-87540073 AGCTGCAGGAGGCTCTCGATAGG + Intergenic
1101533275 12:105594344-105594366 AGCTGCATGGTCCTCTCCATAGG + Intergenic
1101953132 12:109191774-109191796 AGCTGCCTGTGTCTCCCCTCTGG + Intronic
1104083937 12:125457672-125457694 AGCTGCCTGGGGCTCTGCAAGGG + Intronic
1104188767 12:126457963-126457985 AGCTGCAAGTGGCTTTCCTGCGG + Intergenic
1104995470 12:132651773-132651795 TGCTCCATGGGGCTCTTCACAGG - Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1110157447 13:72334994-72335016 AACTGCATGTGGCTCTCTCATGG - Intergenic
1113490031 13:110684213-110684235 AGCAGCATGTAGCTGTCCTCAGG + Intronic
1113772040 13:112916653-112916675 AGCTGCATGAAGCGTTCCACCGG + Intronic
1116245269 14:42403625-42403647 AGCTACATGTCACTCTGCACTGG - Intergenic
1117583792 14:57179490-57179512 AGCTGCGTGTGGCTCTGTGCTGG + Intergenic
1124011393 15:25842138-25842160 AGCAGCATCAGGCTGTCCACTGG + Intronic
1125451029 15:39807878-39807900 AGCTGCATGTGGCTATTGAAAGG - Intronic
1128802400 15:70505087-70505109 AGCTGCATGTGGTGCCCCACAGG + Intergenic
1129188907 15:73926549-73926571 GGCTGCACGAGGCTCTCCGCAGG - Exonic
1129331346 15:74829096-74829118 AGCTGCTTCTGACTCCCCACAGG + Intronic
1129453996 15:75666857-75666879 AGCTGCATGTGGCAGTCCTGTGG + Intergenic
1129932055 15:79419428-79419450 TGCTGCCTGTGACTGTCCACTGG + Intronic
1130911739 15:88275592-88275614 AGCTCCATGTGCTTCTCCATGGG - Intergenic
1131273201 15:90959380-90959402 AGCTGCACGTGGCTTTCATCAGG + Intronic
1139582709 16:67882844-67882866 AGCTGCATGTGGCTGTGGGCAGG + Exonic
1141360781 16:83393233-83393255 AGAGGCATTTGGCTCTGCACTGG + Intronic
1142250813 16:88991031-88991053 AGCTGCCTGAGGCCCTCCCCAGG - Intergenic
1143900172 17:10168543-10168565 AGCGGTTTGTGGCTCTCCAGCGG - Intronic
1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG + Intronic
1146399466 17:32491894-32491916 TGCTGGATGTGGCCCTCCCCAGG + Intergenic
1148616538 17:49004579-49004601 AGCTGTTTGTGTCTGTCCACAGG + Intronic
1148700075 17:49581835-49581857 GCCAGCATCTGGCTCTCCACAGG - Intronic
1148913367 17:50955102-50955124 ATCTGCCTGTGGCTCTGCACAGG + Intergenic
1152139747 17:78529476-78529498 AGCTTCAAGTGGATCTCCTCTGG + Exonic
1152819714 17:82430826-82430848 AGAAGCATGTAGCTCTACACTGG - Intronic
1153311074 18:3677619-3677641 AGCTGGATGTGGCTGAGCACTGG - Intronic
1153384803 18:4480040-4480062 ACCAGCATGTTGCTCTTCACTGG + Intergenic
1153816541 18:8795175-8795197 AGCTGCCTCTGACTCTTCACTGG + Intronic
1154120920 18:11651905-11651927 TGCTGCATGGGCCTCTCCACAGG - Intergenic
1155259006 18:24023366-24023388 ACCTGCATGTGGCTCAGCAGCGG - Intronic
1157570685 18:48710163-48710185 GGCTGCATGTGCCCCACCACAGG + Intronic
1159941488 18:74412255-74412277 AGCTTCAAGTAGCTCTCCGCGGG + Intergenic
1161379602 19:3958120-3958142 ACCTGCATGTGGCTCCAGACGGG + Intergenic
1163627996 19:18401952-18401974 AGCTGCATGAGGCTCACTGCTGG - Intergenic
1165317824 19:35067257-35067279 GGCTGCATGAGGCTCTGCAGAGG - Intergenic
1166520633 19:43477946-43477968 AGCTGCGGGTGGCTTTCCCCAGG + Intronic
1167216957 19:48171157-48171179 AGCTGCATGTGGCGAGCCATAGG + Intronic
1167521650 19:49959217-49959239 AACTGCATGAGGGTCTACACAGG + Intronic
1167523731 19:49971505-49971527 AACTGCATGAGGGTCTACACAGG - Intergenic
1167710239 19:51105991-51106013 GGCTGCATGGGGCTCCCCACAGG + Intronic
1167756333 19:51415755-51415777 AACTGCATGAGGGTCTACACAGG + Intronic
931150488 2:59567566-59567588 AACTGCAAGTGTCTCTCCATAGG + Intergenic
936064921 2:109323583-109323605 AGCTGAATGTGCATCTGCACTGG + Intronic
936477044 2:112848389-112848411 ACCTGCATTGGGCTCACCACAGG + Intergenic
938551242 2:132384271-132384293 AACTGCACGTGGGTCTCCACTGG - Intergenic
938954959 2:136288755-136288777 AGCTTCATGTGCCTCCCCAAGGG + Intergenic
943477204 2:188372226-188372248 AGCTGCATCTAGTTCTCCAGAGG + Intronic
947490670 2:230591933-230591955 ACCTGCATGTGCCTGTCCACCGG - Intergenic
948253351 2:236548688-236548710 AGCTCCATGTGACTCTCTAATGG + Intergenic
1170158274 20:13287934-13287956 AGCTGCATTCAGCTGTCCACTGG + Intronic
1173201966 20:40961012-40961034 AGCTGAGTGTGAATCTCCACTGG + Intergenic
1174105479 20:48159366-48159388 AGCTGCTAGTGGCTCTCTGCAGG - Intergenic
1174476446 20:50799399-50799421 GGCTGCATGTGACTCTGCTCTGG - Intronic
1174698095 20:52580456-52580478 AGCTGCTTGTGCCTCTCATCTGG + Intergenic
1175802712 20:61810267-61810289 GGCCACATGTGGCTATCCACCGG + Intronic
1175846503 20:62062071-62062093 AGCTGCATGTGGGTGTCAAGTGG - Intronic
1176072354 20:63233943-63233965 TGCTGCATGTGTCTCTCCCCTGG + Intergenic
1179633942 21:42695561-42695583 TGCCGCAGGTGACTCTCCACCGG + Intronic
1180144560 21:45912117-45912139 AGCTGCACCTGGCACTGCACCGG - Intronic
1180656408 22:17424684-17424706 AGCTGCAGGTGCATTTCCACAGG - Intronic
1181287154 22:21761231-21761253 AGCTACATGTAGCTCACCAGTGG - Exonic
1183664211 22:39238047-39238069 AGCTGCAGCCGGCTCTCCAGTGG - Intronic
1183992460 22:41607013-41607035 AGCTGTTTCTGGTTCTCCACAGG - Intronic
1184298494 22:43541220-43541242 AGTTGCTTCTGGGTCTCCACTGG + Intronic
1185114572 22:48924544-48924566 AGGTGCAGGTGGCCCTCCCCAGG + Intergenic
949771615 3:7585643-7585665 AGCTCCAGGGAGCTCTCCACGGG - Intronic
953750126 3:45602343-45602365 AGCAGAATGTGGCTCTCTCCTGG - Intronic
955752738 3:62199033-62199055 ATCAGCATGTGGCTTTCCACTGG - Intronic
956708289 3:72018364-72018386 AGCTGCAAGTTGCTTCCCACTGG + Intergenic
963285459 3:143430638-143430660 AGCTGCATGTGGCCCTCTGGGGG + Intronic
967281312 3:187826707-187826729 AGAAGCAAGTGGCTCTCCAAAGG - Intergenic
968231684 3:197008303-197008325 AGTGGCATGAGCCTCTCCACAGG - Intronic
969151021 4:5168487-5168509 ATTTGCATTTGGCTCCCCACAGG - Intronic
969523971 4:7694871-7694893 AGCTGAACGTGGCTGTCCAAGGG - Intronic
971796815 4:31238904-31238926 AGATGGAGGTGGCTCTCAACAGG + Intergenic
972941118 4:44196656-44196678 AGCTTCTTCTGGCTCTGCACTGG - Intronic
976320154 4:83704958-83704980 TGCAACATGGGGCTCTCCACAGG + Intergenic
985298852 4:188465287-188465309 CACAGCCTGTGGCTCTCCACAGG + Intergenic
988479538 5:31618516-31618538 AGCTCCCTGTGGCTCCCGACTGG - Intergenic
990130379 5:52574874-52574896 AGCAGCCTGAGGCTCTCCAGAGG + Intergenic
991051738 5:62280012-62280034 AGATGCAGGTGGCTGTCCAGTGG + Intergenic
995557707 5:113346123-113346145 AGCTCCAGGTGGCTCAGCACAGG - Intronic
997613043 5:135228563-135228585 AGCTGGCTTTGGCACTCCACTGG + Intronic
1000816714 5:165931760-165931782 TGCTGCATGAGCCTCTCCACAGG + Intergenic
1002664438 5:180811849-180811871 AGCTGCATTGGCCTCTGCACCGG + Intronic
1004057207 6:12151831-12151853 AGCTGCATGTGGCTCTCCACTGG - Intronic
1005814471 6:29539538-29539560 AGCTGCATAAAGCTCTCCATAGG - Intergenic
1005819053 6:29581985-29582007 AGCTGCATGCAGCACACCACTGG - Intronic
1007766782 6:44165464-44165486 CACTGGATGTGGCTCTGCACAGG + Intronic
1008660804 6:53665704-53665726 GGCTGCTGGTGGCTCCCCACCGG - Exonic
1012370036 6:98493010-98493032 TGCTGCATGGGACTCTCCACAGG - Intergenic
1013519913 6:110923626-110923648 AGCTGCGTGTCGATCTCCTCAGG - Intergenic
1015811022 6:137162335-137162357 CACTGCATCTGGCTCTCCACGGG + Intronic
1016769219 6:147829806-147829828 AGCTGCAGATGGTTCTACACAGG + Intergenic
1021621246 7:22552855-22552877 ATCTGCAGGTGGTTCTCCAGGGG - Intronic
1023177793 7:37449859-37449881 AGCTGCCTGTGGCTCTTGAGGGG - Intergenic
1025715721 7:63953560-63953582 AGCTGCCTGAGGCTGTGCACTGG - Intergenic
1029272602 7:99385884-99385906 GGCTCCATGTGGCTGTCCCCTGG + Intronic
1031170431 7:118286184-118286206 AGCAGCATCTGGCTCTCCGCAGG + Intergenic
1032231040 7:130074350-130074372 AGCATCATGTGGCTCTCCTTGGG + Intronic
1034607225 7:152328329-152328351 AGCTGGATGTGGCCCTTCAGAGG + Intronic
1034998041 7:155590798-155590820 AGCTGCCCGTGGCTCGCCTCTGG + Intergenic
1035243456 7:157547263-157547285 AGCTTCAGGTGGCTCTGAACTGG - Intronic
1043572224 8:81617995-81618017 AGCTGCATATGGGTTTGCACCGG - Intergenic
1043860156 8:85307036-85307058 AGCTGGTTGTGGCTCTTCATGGG + Intergenic
1048180904 8:132193367-132193389 AGCTGCACGTGGCTCTAAAGCGG + Intronic
1049572205 8:143374594-143374616 AGCTACCTGTGGCTGTCCCCTGG - Intronic
1050362913 9:4847769-4847791 TGCTGTATGTGCTTCTCCACAGG + Intronic
1053053542 9:34980231-34980253 TGCTGCCTCTAGCTCTCCACGGG + Exonic
1057131627 9:92657999-92658021 AGCTGCATGTGTCCCCTCACAGG + Intronic
1061186298 9:129056241-129056263 TGTTGCACGTGGCTTTCCACTGG + Intronic
1203790650 EBV:149816-149838 AGCTGAATGTCGCTCTGCCCGGG + Intergenic
1194324096 X:92489581-92489603 AGCTGCATGTGGATCTGAAGGGG - Intronic
1197602246 X:128543868-128543890 TGCTCCATGTGGCTCTCAAGTGG + Intergenic
1200632199 Y:5602674-5602696 AGCTGCATGTGGATCTGAAGGGG - Intronic