ID: 1004065308

View in Genome Browser
Species Human (GRCh38)
Location 6:12238319-12238341
Sequence GACAGGGACTGGCCTTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004065308_1004065317 13 Left 1004065308 6:12238319-12238341 CCATGATAAGGCCAGTCCCTGTC No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data
1004065308_1004065319 23 Left 1004065308 6:12238319-12238341 CCATGATAAGGCCAGTCCCTGTC No data
Right 1004065319 6:12238365-12238387 CTGCGTCATGGGGAAAGTGAAGG No data
1004065308_1004065315 11 Left 1004065308 6:12238319-12238341 CCATGATAAGGCCAGTCCCTGTC No data
Right 1004065315 6:12238353-12238375 ATTTCTCAAGTCCTGCGTCATGG No data
1004065308_1004065316 12 Left 1004065308 6:12238319-12238341 CCATGATAAGGCCAGTCCCTGTC No data
Right 1004065316 6:12238354-12238376 TTTCTCAAGTCCTGCGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004065308 Original CRISPR GACAGGGACTGGCCTTATCA TGG (reversed) Intergenic
No off target data available for this crispr