ID: 1004065313

View in Genome Browser
Species Human (GRCh38)
Location 6:12238341-12238363
Sequence ACTTGAGAAATGACTCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004065313_1004065316 -10 Left 1004065313 6:12238341-12238363 CCCAGTGGAGTCATTTCTCAAGT No data
Right 1004065316 6:12238354-12238376 TTTCTCAAGTCCTGCGTCATGGG No data
1004065313_1004065319 1 Left 1004065313 6:12238341-12238363 CCCAGTGGAGTCATTTCTCAAGT No data
Right 1004065319 6:12238365-12238387 CTGCGTCATGGGGAAAGTGAAGG No data
1004065313_1004065317 -9 Left 1004065313 6:12238341-12238363 CCCAGTGGAGTCATTTCTCAAGT No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004065313 Original CRISPR ACTTGAGAAATGACTCCACT GGG (reversed) Intergenic
No off target data available for this crispr