ID: 1004065314

View in Genome Browser
Species Human (GRCh38)
Location 6:12238342-12238364
Sequence GACTTGAGAAATGACTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004065314_1004065317 -10 Left 1004065314 6:12238342-12238364 CCAGTGGAGTCATTTCTCAAGTC No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data
1004065314_1004065319 0 Left 1004065314 6:12238342-12238364 CCAGTGGAGTCATTTCTCAAGTC No data
Right 1004065319 6:12238365-12238387 CTGCGTCATGGGGAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004065314 Original CRISPR GACTTGAGAAATGACTCCAC TGG (reversed) Intergenic
No off target data available for this crispr