ID: 1004065317

View in Genome Browser
Species Human (GRCh38)
Location 6:12238355-12238377
Sequence TTCTCAAGTCCTGCGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004065313_1004065317 -9 Left 1004065313 6:12238341-12238363 CCCAGTGGAGTCATTTCTCAAGT No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data
1004065311_1004065317 -3 Left 1004065311 6:12238335-12238357 CCCTGTCCCAGTGGAGTCATTTC No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data
1004065310_1004065317 2 Left 1004065310 6:12238330-12238352 CCAGTCCCTGTCCCAGTGGAGTC No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data
1004065314_1004065317 -10 Left 1004065314 6:12238342-12238364 CCAGTGGAGTCATTTCTCAAGTC No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data
1004065308_1004065317 13 Left 1004065308 6:12238319-12238341 CCATGATAAGGCCAGTCCCTGTC No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data
1004065312_1004065317 -4 Left 1004065312 6:12238336-12238358 CCTGTCCCAGTGGAGTCATTTCT No data
Right 1004065317 6:12238355-12238377 TTCTCAAGTCCTGCGTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004065317 Original CRISPR TTCTCAAGTCCTGCGTCATG GGG Intergenic
No off target data available for this crispr