ID: 1004071029

View in Genome Browser
Species Human (GRCh38)
Location 6:12297877-12297899
Sequence TGCAATTGCAGTATTGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004071028_1004071029 6 Left 1004071028 6:12297848-12297870 CCTTGTCAGCTCACTGGAGAGCA No data
Right 1004071029 6:12297877-12297899 TGCAATTGCAGTATTGCAAATGG No data
1004071026_1004071029 16 Left 1004071026 6:12297838-12297860 CCTTGGCTGGCCTTGTCAGCTCA No data
Right 1004071029 6:12297877-12297899 TGCAATTGCAGTATTGCAAATGG No data
1004071023_1004071029 29 Left 1004071023 6:12297825-12297847 CCTCTCCACTTTGCCTTGGCTGG No data
Right 1004071029 6:12297877-12297899 TGCAATTGCAGTATTGCAAATGG No data
1004071025_1004071029 24 Left 1004071025 6:12297830-12297852 CCACTTTGCCTTGGCTGGCCTTG No data
Right 1004071029 6:12297877-12297899 TGCAATTGCAGTATTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004071029 Original CRISPR TGCAATTGCAGTATTGCAAA TGG Intergenic
No off target data available for this crispr