ID: 1004072254

View in Genome Browser
Species Human (GRCh38)
Location 6:12311293-12311315
Sequence CAACAGAGGGAGTCCTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004072249_1004072254 1 Left 1004072249 6:12311269-12311291 CCAAGCTATTCAAGTTATTGCAC No data
Right 1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG No data
1004072248_1004072254 2 Left 1004072248 6:12311268-12311290 CCCAAGCTATTCAAGTTATTGCA No data
Right 1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004072254 Original CRISPR CAACAGAGGGAGTCCTTGTA AGG Intergenic
No off target data available for this crispr