ID: 1004074876

View in Genome Browser
Species Human (GRCh38)
Location 6:12335980-12336002
Sequence AGTTAATTGCAGAATAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004074876_1004074880 3 Left 1004074876 6:12335980-12336002 CCTGTCCTATTCTGCAATTAACT No data
Right 1004074880 6:12336006-12336028 GGCTTTTGTTTTCTTTTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004074876 Original CRISPR AGTTAATTGCAGAATAGGAC AGG (reversed) Intergenic
No off target data available for this crispr