ID: 1004075964

View in Genome Browser
Species Human (GRCh38)
Location 6:12344425-12344447
Sequence ACAGCTTGAGTGAGGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004075961_1004075964 -2 Left 1004075961 6:12344404-12344426 CCTTAACTGTTGCCATCAGAAAC No data
Right 1004075964 6:12344425-12344447 ACAGCTTGAGTGAGGCAAGCAGG No data
1004075960_1004075964 29 Left 1004075960 6:12344373-12344395 CCTCTCTAGAGGTCTAAGGGACA No data
Right 1004075964 6:12344425-12344447 ACAGCTTGAGTGAGGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004075964 Original CRISPR ACAGCTTGAGTGAGGCAAGC AGG Intergenic
No off target data available for this crispr