ID: 1004079449

View in Genome Browser
Species Human (GRCh38)
Location 6:12376926-12376948
Sequence CAGTGGGAGAATGGCTGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004079449_1004079458 19 Left 1004079449 6:12376926-12376948 CCTTATCAGCCATTCTCCCACTG No data
Right 1004079458 6:12376968-12376990 TGCATTGAAACTGGAGGATAAGG No data
1004079449_1004079459 20 Left 1004079449 6:12376926-12376948 CCTTATCAGCCATTCTCCCACTG No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079449_1004079456 10 Left 1004079449 6:12376926-12376948 CCTTATCAGCCATTCTCCCACTG No data
Right 1004079456 6:12376959-12376981 TGGCTGGATTGCATTGAAACTGG No data
1004079449_1004079460 21 Left 1004079449 6:12376926-12376948 CCTTATCAGCCATTCTCCCACTG No data
Right 1004079460 6:12376970-12376992 CATTGAAACTGGAGGATAAGGGG No data
1004079449_1004079457 13 Left 1004079449 6:12376926-12376948 CCTTATCAGCCATTCTCCCACTG No data
Right 1004079457 6:12376962-12376984 CTGGATTGCATTGAAACTGGAGG No data
1004079449_1004079451 -10 Left 1004079449 6:12376926-12376948 CCTTATCAGCCATTCTCCCACTG No data
Right 1004079451 6:12376939-12376961 TCTCCCACTGTGCTTTCCTTTGG No data
1004079449_1004079454 -6 Left 1004079449 6:12376926-12376948 CCTTATCAGCCATTCTCCCACTG No data
Right 1004079454 6:12376943-12376965 CCACTGTGCTTTCCTTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004079449 Original CRISPR CAGTGGGAGAATGGCTGATA AGG (reversed) Intergenic
No off target data available for this crispr