ID: 1004079459

View in Genome Browser
Species Human (GRCh38)
Location 6:12376969-12376991
Sequence GCATTGAAACTGGAGGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004079444_1004079459 27 Left 1004079444 6:12376919-12376941 CCCCTCCCCTTATCAGCCATTCT No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079447_1004079459 22 Left 1004079447 6:12376924-12376946 CCCCTTATCAGCCATTCTCCCAC No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079450_1004079459 11 Left 1004079450 6:12376935-12376957 CCATTCTCCCACTGTGCTTTCCT No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079449_1004079459 20 Left 1004079449 6:12376926-12376948 CCTTATCAGCCATTCTCCCACTG No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079453_1004079459 3 Left 1004079453 6:12376943-12376965 CCACTGTGCTTTCCTTTGGCTGG No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079452_1004079459 4 Left 1004079452 6:12376942-12376964 CCCACTGTGCTTTCCTTTGGCTG No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079446_1004079459 25 Left 1004079446 6:12376921-12376943 CCTCCCCTTATCAGCCATTCTCC No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079455_1004079459 -9 Left 1004079455 6:12376955-12376977 CCTTTGGCTGGATTGCATTGAAA No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079445_1004079459 26 Left 1004079445 6:12376920-12376942 CCCTCCCCTTATCAGCCATTCTC No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data
1004079448_1004079459 21 Left 1004079448 6:12376925-12376947 CCCTTATCAGCCATTCTCCCACT No data
Right 1004079459 6:12376969-12376991 GCATTGAAACTGGAGGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004079459 Original CRISPR GCATTGAAACTGGAGGATAA GGG Intergenic
No off target data available for this crispr