ID: 1004084285

View in Genome Browser
Species Human (GRCh38)
Location 6:12429434-12429456
Sequence ACACACACAGGCACACAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004084285_1004084289 2 Left 1004084285 6:12429434-12429456 CCCTTCTGTGTGCCTGTGTGTGT No data
Right 1004084289 6:12429459-12429481 GTGCATAAAGTGTGTGGCTATGG No data
1004084285_1004084290 7 Left 1004084285 6:12429434-12429456 CCCTTCTGTGTGCCTGTGTGTGT No data
Right 1004084290 6:12429464-12429486 TAAAGTGTGTGGCTATGGTATGG No data
1004084285_1004084288 -4 Left 1004084285 6:12429434-12429456 CCCTTCTGTGTGCCTGTGTGTGT No data
Right 1004084288 6:12429453-12429475 GTGTGTGTGCATAAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004084285 Original CRISPR ACACACACAGGCACACAGAA GGG (reversed) Intergenic
No off target data available for this crispr