ID: 1004084286

View in Genome Browser
Species Human (GRCh38)
Location 6:12429435-12429457
Sequence CACACACACAGGCACACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004084286_1004084289 1 Left 1004084286 6:12429435-12429457 CCTTCTGTGTGCCTGTGTGTGTG No data
Right 1004084289 6:12429459-12429481 GTGCATAAAGTGTGTGGCTATGG No data
1004084286_1004084288 -5 Left 1004084286 6:12429435-12429457 CCTTCTGTGTGCCTGTGTGTGTG No data
Right 1004084288 6:12429453-12429475 GTGTGTGTGCATAAAGTGTGTGG No data
1004084286_1004084290 6 Left 1004084286 6:12429435-12429457 CCTTCTGTGTGCCTGTGTGTGTG No data
Right 1004084290 6:12429464-12429486 TAAAGTGTGTGGCTATGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004084286 Original CRISPR CACACACACAGGCACACAGA AGG (reversed) Intergenic
No off target data available for this crispr