ID: 1004084289

View in Genome Browser
Species Human (GRCh38)
Location 6:12429459-12429481
Sequence GTGCATAAAGTGTGTGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004084284_1004084289 27 Left 1004084284 6:12429409-12429431 CCTGAATCTATGAAGTGCATGCA No data
Right 1004084289 6:12429459-12429481 GTGCATAAAGTGTGTGGCTATGG No data
1004084287_1004084289 -10 Left 1004084287 6:12429446-12429468 CCTGTGTGTGTGTGTGCATAAAG No data
Right 1004084289 6:12429459-12429481 GTGCATAAAGTGTGTGGCTATGG No data
1004084286_1004084289 1 Left 1004084286 6:12429435-12429457 CCTTCTGTGTGCCTGTGTGTGTG No data
Right 1004084289 6:12429459-12429481 GTGCATAAAGTGTGTGGCTATGG No data
1004084285_1004084289 2 Left 1004084285 6:12429434-12429456 CCCTTCTGTGTGCCTGTGTGTGT No data
Right 1004084289 6:12429459-12429481 GTGCATAAAGTGTGTGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004084289 Original CRISPR GTGCATAAAGTGTGTGGCTA TGG Intergenic
No off target data available for this crispr