ID: 1004090013

View in Genome Browser
Species Human (GRCh38)
Location 6:12491403-12491425
Sequence TCCATTGTTTTGTCTACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004090013_1004090014 7 Left 1004090013 6:12491403-12491425 CCAAGAGTAGACAAAACAATGGA No data
Right 1004090014 6:12491433-12491455 GCCAGAGTGTGCAAAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004090013 Original CRISPR TCCATTGTTTTGTCTACTCT TGG (reversed) Intergenic
No off target data available for this crispr