ID: 1004090014

View in Genome Browser
Species Human (GRCh38)
Location 6:12491433-12491455
Sequence GCCAGAGTGTGCAAAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004090013_1004090014 7 Left 1004090013 6:12491403-12491425 CCAAGAGTAGACAAAACAATGGA No data
Right 1004090014 6:12491433-12491455 GCCAGAGTGTGCAAAGAATGAGG No data
1004090011_1004090014 26 Left 1004090011 6:12491384-12491406 CCTACAGTTCAGATGCTCTCCAA No data
Right 1004090014 6:12491433-12491455 GCCAGAGTGTGCAAAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004090014 Original CRISPR GCCAGAGTGTGCAAAGAATG AGG Intergenic
No off target data available for this crispr