ID: 1004095217

View in Genome Browser
Species Human (GRCh38)
Location 6:12547560-12547582
Sequence GACGGCAATCAGGATGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004095204_1004095217 28 Left 1004095204 6:12547509-12547531 CCATGCCCCGTTTGAAAGCTCCT No data
Right 1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG No data
1004095206_1004095217 23 Left 1004095206 6:12547514-12547536 CCCCGTTTGAAAGCTCCTTGGAC No data
Right 1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG No data
1004095208_1004095217 21 Left 1004095208 6:12547516-12547538 CCGTTTGAAAGCTCCTTGGACCC No data
Right 1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG No data
1004095209_1004095217 8 Left 1004095209 6:12547529-12547551 CCTTGGACCCTCTTCTCTCCTCC No data
Right 1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG No data
1004095211_1004095217 1 Left 1004095211 6:12547536-12547558 CCCTCTTCTCTCCTCCTGGACAC No data
Right 1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG No data
1004095207_1004095217 22 Left 1004095207 6:12547515-12547537 CCCGTTTGAAAGCTCCTTGGACC No data
Right 1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG No data
1004095214_1004095217 -10 Left 1004095214 6:12547547-12547569 CCTCCTGGACACAGACGGCAATC No data
Right 1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG No data
1004095212_1004095217 0 Left 1004095212 6:12547537-12547559 CCTCTTCTCTCCTCCTGGACACA No data
Right 1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004095217 Original CRISPR GACGGCAATCAGGATGACAC TGG Intergenic
No off target data available for this crispr