ID: 1004101359

View in Genome Browser
Species Human (GRCh38)
Location 6:12615461-12615483
Sequence CCAATTCCTAAGCCTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004101359_1004101363 -1 Left 1004101359 6:12615461-12615483 CCAGGGAAAGGCTTAGGAATTGG No data
Right 1004101363 6:12615483-12615505 GAGGCACTGGATACTTTGAAAGG No data
1004101359_1004101368 18 Left 1004101359 6:12615461-12615483 CCAGGGAAAGGCTTAGGAATTGG No data
Right 1004101368 6:12615502-12615524 AAGGTGAAGGTCAGGGAGAAGGG No data
1004101359_1004101367 17 Left 1004101359 6:12615461-12615483 CCAGGGAAAGGCTTAGGAATTGG No data
Right 1004101367 6:12615501-12615523 AAAGGTGAAGGTCAGGGAGAAGG No data
1004101359_1004101365 10 Left 1004101359 6:12615461-12615483 CCAGGGAAAGGCTTAGGAATTGG No data
Right 1004101365 6:12615494-12615516 TACTTTGAAAGGTGAAGGTCAGG No data
1004101359_1004101366 11 Left 1004101359 6:12615461-12615483 CCAGGGAAAGGCTTAGGAATTGG No data
Right 1004101366 6:12615495-12615517 ACTTTGAAAGGTGAAGGTCAGGG No data
1004101359_1004101364 5 Left 1004101359 6:12615461-12615483 CCAGGGAAAGGCTTAGGAATTGG No data
Right 1004101364 6:12615489-12615511 CTGGATACTTTGAAAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004101359 Original CRISPR CCAATTCCTAAGCCTTTCCC TGG (reversed) Intergenic
No off target data available for this crispr