ID: 1004101366

View in Genome Browser
Species Human (GRCh38)
Location 6:12615495-12615517
Sequence ACTTTGAAAGGTGAAGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004101358_1004101366 12 Left 1004101358 6:12615460-12615482 CCCAGGGAAAGGCTTAGGAATTG No data
Right 1004101366 6:12615495-12615517 ACTTTGAAAGGTGAAGGTCAGGG No data
1004101359_1004101366 11 Left 1004101359 6:12615461-12615483 CCAGGGAAAGGCTTAGGAATTGG No data
Right 1004101366 6:12615495-12615517 ACTTTGAAAGGTGAAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004101366 Original CRISPR ACTTTGAAAGGTGAAGGTCA GGG Intergenic
No off target data available for this crispr