ID: 1004108779

View in Genome Browser
Species Human (GRCh38)
Location 6:12693683-12693705
Sequence CCTGGCATTATGGGAGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004108772_1004108779 28 Left 1004108772 6:12693632-12693654 CCTAGGAGGAAATACTTGTTATC No data
Right 1004108779 6:12693683-12693705 CCTGGCATTATGGGAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004108779 Original CRISPR CCTGGCATTATGGGAGTGTC AGG Intergenic
No off target data available for this crispr