ID: 1004112173

View in Genome Browser
Species Human (GRCh38)
Location 6:12729705-12729727
Sequence ACATACAGGACACACTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004112173 Original CRISPR ACATACAGGACACACTGGGG AGG Intronic
902195178 1:14792991-14793013 ACATTCAGGACACAGTTGGCGGG + Intronic
902328808 1:15720375-15720397 ACACACAGGACACAGTGGCAAGG - Intronic
903855868 1:26337293-26337315 CCAGACTGGTCACACTGGGGAGG - Exonic
906245655 1:44271986-44272008 ACATACAGGACATTGTGGGCAGG - Intronic
906907681 1:49913426-49913448 ACATCCAGGGCACACTGGTGTGG + Intronic
908179212 1:61587567-61587589 ACCTACTGGACACACTGGGATGG + Intergenic
908900637 1:68952415-68952437 ACCTTCTGGACACATTGGGGTGG - Intergenic
909468480 1:76000911-76000933 AACTTCTGGACACACTGGGGTGG + Intergenic
909542649 1:76807775-76807797 ATATCCTGGACACACTAGGGTGG - Intergenic
910333086 1:86098063-86098085 AAAAACAGGATACACTGGAGGGG + Intronic
912251612 1:108017831-108017853 ACATAAAGAACACACTGGAAAGG + Intergenic
912945757 1:114082694-114082716 CCATCCAGGGCAGACTGGGGAGG + Intergenic
913278678 1:117164249-117164271 ACATACAGGGCACTCCTGGGTGG - Intronic
913494507 1:119415931-119415953 ACAGGCAGGACCCACTGGTGAGG - Intronic
914335274 1:146709403-146709425 AGATCCAGGAAACACTGTGGAGG - Intergenic
915681525 1:157586301-157586323 ACATGCAGGAGAGTCTGGGGAGG - Exonic
916566572 1:165983992-165984014 GCATCCTGGACACACTGGGGTGG + Intergenic
922682696 1:227613788-227613810 ACACACAGGACACACAGTAGAGG - Intronic
922683203 1:227618028-227618050 ACAGACTGGACACTCAGGGGTGG - Intronic
923261217 1:232269735-232269757 GCAGACAGGACACACTTGTGGGG - Intergenic
923375462 1:233357708-233357730 ACACACAGCACACAAGGGGGTGG + Intronic
1062789107 10:290083-290105 ACAGAGAGGAGACGCTGGGGAGG + Intronic
1064322598 10:14319899-14319921 ACATACAAGCCACTCTGGAGTGG - Intronic
1067288937 10:44927568-44927590 ACACACAGCACACACTGGGGTGG + Intronic
1069730483 10:70608609-70608631 ACCTTCTGCACACACTGGGGTGG - Intergenic
1070744166 10:78922772-78922794 ACCTACAGGGCACACAAGGGTGG - Intergenic
1075724259 10:124603595-124603617 ACATACAGGACCTTCTCGGGCGG - Intronic
1075830846 10:125409427-125409449 ACAATCGGGACACACTGGGGAGG + Intergenic
1078763087 11:14267561-14267583 ACAAACATGAGACACTAGGGTGG - Exonic
1080128988 11:28770766-28770788 ACCTCCTGGACACACTGGAGTGG - Intergenic
1080202254 11:29686023-29686045 ACATACAGAATACACTTGGAAGG - Intergenic
1080264235 11:30384962-30384984 ACATACAGGGCACACTGGTATGG - Intronic
1081968705 11:47184701-47184723 GCAGACAGGACACACTGCAGAGG - Intronic
1089169686 11:116503316-116503338 ACACCCAGGACACACAGAGGAGG - Intergenic
1089617677 11:119704209-119704231 AAAAAAAGGAAACACTGGGGTGG - Intronic
1089863901 11:121615275-121615297 GCAAAGGGGACACACTGGGGAGG - Intronic
1090137006 11:124209552-124209574 GCAGACAGGAAACCCTGGGGTGG + Intergenic
1090762453 11:129849413-129849435 ACCTTCTGAACACACTGGGGTGG + Intronic
1091175524 11:133554289-133554311 AGATAAAGGAAACACTGGGAAGG + Intergenic
1091310196 11:134568412-134568434 ACATGCAGGACACACTTTGTAGG - Intergenic
1092196456 12:6552399-6552421 ACCTACGGGACACACAGGGAAGG - Intronic
1092784465 12:12015011-12015033 ACATACATGACAGGCTGGGTGGG + Intergenic
1093007019 12:14061905-14061927 AAATACAGGTCCCACTGTGGGGG + Intergenic
1097464578 12:59906585-59906607 ACATACAGGGCACTCTTGGATGG - Intergenic
1099905954 12:88770157-88770179 ACATATTAGACACACTAGGGTGG + Intergenic
1099982269 12:89618651-89618673 ATATGCAGGTCATACTGGGGAGG - Intronic
1101515802 12:105434198-105434220 ACATCCTGGGCACACTGGGGTGG + Intergenic
1102228416 12:111245764-111245786 ACAAACAGGAGGCACTTGGGTGG - Intronic
1103357896 12:120335295-120335317 ACATCCAGGGCACACTGTGTGGG + Intergenic
1105417286 13:20224492-20224514 GCAAACAGGACCCGCTGGGGAGG - Intronic
1107857590 13:44631129-44631151 GCATCCTGGGCACACTGGGGTGG - Intergenic
1107955828 13:45510467-45510489 ACCTAATGGACACCCTGGGGAGG - Intronic
1108853689 13:54767334-54767356 ACAAAAAGGAAACACTGGGCTGG - Intergenic
1109568259 13:64149060-64149082 ACAAACACGTCACACTGGTGGGG - Intergenic
1110371650 13:74747535-74747557 ACATACAGGACATTCTTGGGTGG - Intergenic
1112884099 13:104147596-104147618 ACATTCTGGACCCACTAGGGTGG + Intergenic
1113080628 13:106516175-106516197 CGGTACAGGACACACTGAGGAGG + Intronic
1113450002 13:110402443-110402465 GCCTTCTGGACACACTGGGGTGG + Intronic
1113510857 13:110853794-110853816 GGCTACAGGAGACACTGGGGAGG + Intergenic
1113750975 13:112776239-112776261 ACACACAGGACACACTACAGGGG - Intronic
1113776305 13:112947648-112947670 ACCTTCTGGACACCCTGGGGTGG + Intronic
1113817708 13:113186129-113186151 ACAAAAAGTACACACTGTGGTGG + Intronic
1114098950 14:19361302-19361324 ACAGCCAGGACACAGCGGGGCGG - Intergenic
1114482535 14:23044574-23044596 CCAGAAAGGACACAGTGGGGAGG + Intergenic
1116234845 14:42266704-42266726 ACATACAGGAAACACAAGCGAGG + Intergenic
1117669272 14:58089951-58089973 ACATACAGCACACACTTTGTAGG + Intronic
1118020648 14:61710085-61710107 ACATACATTACACACAGGAGTGG + Intronic
1118193360 14:63601390-63601412 ACATACAGCCCACCCTGGAGAGG - Intronic
1118697700 14:68400645-68400667 ACAGATAGAACACACTGTGGGGG + Intronic
1125136124 15:36345303-36345325 ATCTTCTGGACACACTGGGGTGG - Intergenic
1125215034 15:37262322-37262344 GCATTCAGGACATGCTGGGGAGG + Intergenic
1125601451 15:40917945-40917967 ACTAACAGGCCACGCTGGGGCGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1128109293 15:65066806-65066828 TCTTACAGAACACTCTGGGGAGG + Intronic
1128902084 15:71433566-71433588 ACTCAGGGGACACACTGGGGAGG - Intronic
1129189955 15:73931349-73931371 ACATGCAGGACAGACTGAAGAGG - Intronic
1130997185 15:88910445-88910467 TCATCCAGGAAACACTGGGAGGG + Intronic
1131578834 15:93620104-93620126 ACATACAGCAACCACTGGGAAGG - Intergenic
1131904058 15:97121779-97121801 AGATACAGGGCACACTGTGCAGG - Intergenic
1131995454 15:98128529-98128551 ACAGACAGAACACAATGGGGTGG - Intergenic
1137478337 16:48830094-48830116 GCATACAGGACCCTCTGGGATGG - Intergenic
1138208612 16:55144007-55144029 CCATACATGACTCTCTGGGGTGG + Intergenic
1139998349 16:71001825-71001847 AGATCCAGGAAACACTGTGGAGG + Intronic
1141020120 16:80487619-80487641 ACAGAGAGGACACACTGGTATGG + Intergenic
1141452784 16:84116889-84116911 ACAGACAGGGCACGCTGGGTCGG - Exonic
1142582738 17:952157-952179 AAATTCAGGTCACACTGTGGGGG + Intronic
1144072759 17:11689343-11689365 ACACTCAGGACAGACTGGGGTGG - Intronic
1148386258 17:47237289-47237311 GCAGACAGGAGACCCTGGGGTGG + Intergenic
1148923036 17:51056408-51056430 ACATCAAAGACACACTGAGGTGG - Exonic
1151032522 17:70758016-70758038 ACCTTTTGGACACACTGGGGTGG + Intergenic
1151284094 17:73097242-73097264 AGATCCAGGACTCATTGGGGTGG - Intergenic
1151403043 17:73868656-73868678 ACACTCAGGACTCAGTGGGGTGG - Intergenic
1157564120 18:48668281-48668303 ACCCACAGGAGACACTGGGGAGG + Intronic
1159892680 18:73967402-73967424 ACAGAAAGTACACACTCGGGGGG - Intergenic
1160145184 18:76357841-76357863 CCATACAGGACGCACAGGGATGG - Intergenic
1160416883 18:78717797-78717819 ATGTCCAGGACATACTGGGGGGG + Intergenic
1160492776 18:79351859-79351881 AGAGACAGGACAGCCTGGGGAGG + Intronic
1161141567 19:2651179-2651201 GCCTCCAGGACACAGTGGGGAGG - Intronic
1164193036 19:22928911-22928933 ACAGACAGAACCCACTGGTGAGG + Intergenic
1165086376 19:33350979-33351001 ACACACTGGCCAGACTGGGGAGG + Intergenic
1165324849 19:35108635-35108657 ACATACAGAACAGGATGGGGAGG + Intergenic
1166214227 19:41325236-41325258 ACGGACAGGAGACACGGGGGTGG - Intronic
1166823635 19:45596013-45596035 AGATTCAGGAAGCACTGGGGAGG - Intronic
925031408 2:652446-652468 ACTTTCAGGTCACACTGGGCTGG + Intergenic
925285582 2:2713621-2713643 ACACACAGCACAGACTGGTGTGG + Intergenic
927743162 2:25590610-25590632 GCAGACAGGAGACTCTGGGGTGG + Intronic
927849798 2:26491680-26491702 ACACACAGGACACACAGGAAAGG + Intronic
931131714 2:59343540-59343562 ACAAACATAACACTCTGGGGGGG - Intergenic
933161102 2:79026111-79026133 GCATCCAGGACACACTGGGCAGG - Exonic
935436460 2:103040304-103040326 ACTTTCTGGACACACTGTGGTGG + Intergenic
938119252 2:128622338-128622360 TCACACAGGACACTGTGGGGAGG + Intergenic
941092859 2:161198318-161198340 ATTTTCTGGACACACTGGGGTGG + Intronic
942402934 2:175622539-175622561 GCATGCAGGACAAACTGGGAGGG - Intergenic
944089310 2:195887839-195887861 TCTTTCAGTACACACTGGGGAGG - Intronic
946193431 2:218019757-218019779 GAGAACAGGACACACTGGGGAGG - Intergenic
946469133 2:219940077-219940099 ACCTTCCAGACACACTGGGGTGG - Intergenic
946843293 2:223837990-223838012 GAATACAGGACACACTCGCGCGG - Intronic
947581195 2:231319743-231319765 ACATGCAGGACAAGCTGGGAGGG - Intronic
948749252 2:240121176-240121198 AGATACAGGTTTCACTGGGGAGG + Intergenic
1170538590 20:17365832-17365854 ACCTTCTGGACACACTGGGGTGG + Intronic
1172861130 20:38053076-38053098 ACAGGCAGGACAAACTGTGGGGG - Intronic
1175541125 20:59748260-59748282 GCATTCAGGACATGCTGGGGCGG + Intronic
1177211474 21:18077030-18077052 ACATTCTGGCCCCACTGGGGTGG - Intronic
1177357801 21:20031522-20031544 ACAGACAGGAGACTCTGGGGTGG + Intergenic
1178124188 21:29499571-29499593 AAAAACAGGAAACACTGGTGTGG + Intronic
1178813372 21:35905058-35905080 ACATGAAGGACCCACTGGGGTGG + Intronic
1178903304 21:36615155-36615177 ACCTTCTGGACACACTGGGGTGG + Intergenic
1182745449 22:32602255-32602277 ACACCCCAGACACACTGGGGAGG - Intronic
1185274156 22:49943214-49943236 GCAGACAGGACACGCTGTGGTGG + Intergenic
949214690 3:1551683-1551705 ACTATCTGGACACACTGGGGTGG - Intergenic
949724442 3:7027018-7027040 ACAGGCAGAACACAATGGGGAGG - Intronic
950424891 3:12919776-12919798 ACACAGGGGACACACTGGGCTGG + Intronic
952965851 3:38620789-38620811 CCTTGCAGGCCACACTGGGGTGG - Intronic
953645164 3:44746995-44747017 TCCTCCTGGACACACTGGGGCGG + Intronic
957359875 3:79141232-79141254 AAATACAGGACACACGAGGGAGG - Intronic
959623796 3:108426854-108426876 ACCTTCTGGACATACTGGGGTGG - Intronic
960459608 3:117917324-117917346 ACATACAGGGCACCCTGTTGAGG + Intergenic
961434305 3:126906135-126906157 ACATAGAGGAGACAATGGGTGGG - Intronic
967811867 3:193767430-193767452 ATACACAGGACACACTGAGGTGG - Intergenic
970635466 4:18005269-18005291 ACATCCAGGTCACACTGGATGGG + Intronic
971248754 4:24954042-24954064 ACCTATAGGACACATTGTGGAGG + Intronic
971911017 4:32798096-32798118 ACTGACATGACACACTGGTGGGG - Intergenic
972274084 4:37541088-37541110 ACATGCTGGACTCACTGGTGGGG - Intronic
973805596 4:54523208-54523230 ACATATAGGGCATATTGGGGTGG + Intergenic
973881654 4:55278891-55278913 ACTTCCTGGACACACTGTGGTGG - Intergenic
975716842 4:77213378-77213400 ATACACAGGACACACAGGGCTGG + Intronic
976115759 4:81724067-81724089 ACAAACAGAACACACTGGTCTGG + Intronic
978852523 4:113355635-113355657 ACCTACAGGACTGACTGAGGAGG + Exonic
982099248 4:151952349-151952371 ACCTACAGGACATGCTGGGTTGG + Intergenic
982303326 4:153902304-153902326 ACATACAGTACACTCAGGGCTGG - Intergenic
982598298 4:157413745-157413767 ACCTTCTGGACACACTGGGATGG + Intergenic
984300343 4:177909443-177909465 ACACACAGCACACACTGTTGTGG - Intronic
984444948 4:179824938-179824960 ACATAAAGGGGACACTGGGATGG - Intergenic
985912009 5:2892008-2892030 ACTTTCAGGACTCACAGGGGTGG + Intergenic
988077752 5:26374030-26374052 ACCTTCCAGACACACTGGGGTGG - Intergenic
989348799 5:40460052-40460074 ACCTTCTGGACACACTGGGATGG - Intergenic
989351914 5:40496350-40496372 ACATACAGGACACCCTATGAGGG + Intergenic
990318433 5:54606566-54606588 GATTACAGGACACTCTGGGGTGG - Intergenic
996759668 5:126974384-126974406 AGAAGTAGGACACACTGGGGAGG - Intronic
996876841 5:128249731-128249753 AAATACAGGATACTCTGGCGGGG - Intergenic
998589658 5:143464049-143464071 ACCTCCTGGACACACTGGGGTGG + Intergenic
999226453 5:150028862-150028884 AAATAAAGAAGACACTGGGGAGG - Intronic
1003516686 6:6824181-6824203 ACATAGAAGACACACTGGCAGGG + Intergenic
1003797099 6:9616719-9616741 ACATATAGGACACATTTGAGGGG + Intronic
1004112173 6:12729705-12729727 ACATACAGGACACACTGGGGAGG + Intronic
1005467188 6:26126559-26126581 ACATACAGGAAATGCTGGGGGGG - Intronic
1006799589 6:36751448-36751470 ACTTACAGAACACAGTGGGCAGG - Intronic
1007987285 6:46219330-46219352 ACATACGGGGCACTCTGGGATGG - Intergenic
1010087535 6:71938196-71938218 ACATCCAGGTCACACTGAGGGGG + Intronic
1012834866 6:104252221-104252243 GCATACTGGGCACACTGGGGTGG - Intergenic
1017005685 6:150026802-150026824 ACATGCAGGACACACATGGGAGG - Intergenic
1018162290 6:161057214-161057236 ACACACAGGAAACACTGAAGAGG + Intronic
1018647964 6:165965329-165965351 ACACAGAGGAGACACTGGTGGGG + Intronic
1019177332 6:170166799-170166821 AGATGGAGGACACACTGGAGTGG - Intergenic
1019363114 7:616117-616139 ACACGCAGAACACACTGGGTGGG + Intronic
1023078359 7:36505092-36505114 ACATAAAGGACACCCAGTGGTGG - Intergenic
1029952690 7:104603831-104603853 ACATGCTGGGCACACTGGGGTGG + Intronic
1031297865 7:120026684-120026706 ACATATTGGACACATGGGGGTGG - Intergenic
1032444413 7:131969477-131969499 ACAAAGAGGAAACACTGAGGTGG + Intergenic
1035071914 7:156151268-156151290 ACATACAGGAAACACGGCAGGGG - Intergenic
1035436884 7:158866176-158866198 ACATTCAGGGGACACTGGGAAGG - Intronic
1040580395 8:48694165-48694187 AACTACAGGACTCACTGGAGTGG - Intergenic
1041498881 8:58518112-58518134 ACATACAGGGCAACCTGGGAAGG - Intergenic
1049458587 8:142709286-142709308 ACATTCTGGACACACTGGGGTGG + Intergenic
1052379646 9:27756232-27756254 ACACACAGGACACACAATGGTGG - Intergenic
1054901370 9:70372573-70372595 ACATTTTGGACACACTTGGGAGG + Intergenic
1056276593 9:84999836-84999858 ACCTACAGGAAACAGTGGGGTGG - Intronic
1056930110 9:90867264-90867286 ACACACAGGGCAGACTGGGCGGG - Intronic
1058271772 9:102981413-102981435 ACCTTCTGGACACATTGGGGTGG - Intergenic
1058275584 9:103037708-103037730 ACTTACAGGACACCCTGTAGAGG + Intergenic
1060137763 9:121173771-121173793 AGATACTGGGCACATTGGGGAGG + Intronic
1060483297 9:124030484-124030506 AAATCCAGGCCACTCTGGGGGGG - Intronic
1061055772 9:128222210-128222232 ACATCCGGGACACACTGCCGGGG + Exonic
1062620076 9:137416690-137416712 ACATCCAGGTCACACCGAGGTGG + Intronic
1187923196 X:24225868-24225890 ACATACAGGATACAATGTGAAGG - Intergenic
1188207802 X:27381016-27381038 ACACACAGGAAACCCTGGAGTGG - Intergenic
1189666177 X:43357347-43357369 ACATTCTGGAAACACTGGAGTGG + Intergenic
1189973127 X:46438056-46438078 ACATCCTGGGCACACTAGGGTGG + Intergenic
1190054233 X:47172647-47172669 ACATAAATGTCAAACTGGGGAGG - Intronic
1192200673 X:69064644-69064666 AAATACAAGACACTCTGGGCTGG + Intergenic
1194720988 X:97340072-97340094 AAGAACAGGACACTCTGGGGAGG - Intronic