ID: 1004113349

View in Genome Browser
Species Human (GRCh38)
Location 6:12743136-12743158
Sequence GTGAACTAACAAGTAATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 5, 3: 100, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004113349_1004113351 -9 Left 1004113349 6:12743136-12743158 CCAGAGATTACTTGTTAGTTCAC 0: 1
1: 0
2: 5
3: 100
4: 196
Right 1004113351 6:12743150-12743172 TTAGTTCACAAGAATAAGCAGGG No data
1004113349_1004113352 8 Left 1004113349 6:12743136-12743158 CCAGAGATTACTTGTTAGTTCAC 0: 1
1: 0
2: 5
3: 100
4: 196
Right 1004113352 6:12743167-12743189 GCAGGGTTAGTCTAAATTGCAGG 0: 4
1: 20
2: 70
3: 106
4: 141
1004113349_1004113350 -10 Left 1004113349 6:12743136-12743158 CCAGAGATTACTTGTTAGTTCAC 0: 1
1: 0
2: 5
3: 100
4: 196
Right 1004113350 6:12743149-12743171 GTTAGTTCACAAGAATAAGCAGG 0: 1
1: 8
2: 72
3: 152
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004113349 Original CRISPR GTGAACTAACAAGTAATCTC TGG (reversed) Intronic
901711106 1:11115852-11115874 GTGACCTAATAAGTCATTTCTGG + Intronic
906859666 1:49346297-49346319 GTGAACCAACCAGTGATCTCTGG + Intronic
906952069 1:50342991-50343013 GTGAACTCATAAATAACCTCAGG - Intergenic
908402790 1:63786860-63786882 GTAAACTAACAAGAAGTCACTGG + Intronic
909099929 1:71337412-71337434 GTGAATCAACCAGTAGTCTCTGG - Intergenic
909200953 1:72689334-72689356 GTGAACCAATAAGTAATCTCTGG - Intergenic
911278729 1:95896627-95896649 GTGAACCAACCAGTGATCTCTGG - Intergenic
911907696 1:103590278-103590300 GTAAACAAACCAGCAATCTCTGG - Intergenic
912094243 1:106119769-106119791 ATGAACCAACCAGTGATCTCTGG + Intergenic
913103379 1:115591125-115591147 GTGAACCAACTAGCAATTTCTGG + Intergenic
913613265 1:120529589-120529611 GTGATCTCACAAGTACTCACCGG - Intergenic
914331494 1:146674842-146674864 GTGAACCAACAAGGAAACTTTGG + Intergenic
914395878 1:147267996-147268018 GTGAACTAACAAATAACCATTGG - Intronic
914817849 1:151076341-151076363 GTGAACCAACCAGTGATCTCTGG - Intronic
916012860 1:160722358-160722380 TTGAACCAACCAGTAATCTCTGG + Intergenic
916539350 1:165737165-165737187 ATTAACAAACAAGAAATCTCAGG + Intronic
916954368 1:169816308-169816330 GTGAACCAACCAGTGATCTCTGG - Intronic
917076987 1:171215590-171215612 GTGAACCAACCAGCAATCCCTGG - Intergenic
917371547 1:174298910-174298932 GTGAACTAACCAGCAATTTCTGG - Intronic
919242227 1:194929579-194929601 GTGAAATTACAAGTAACCTAAGG + Intergenic
919299029 1:195737848-195737870 ATGAACCAACTAGTGATCTCTGG + Intergenic
920838121 1:209530835-209530857 GTGAGCTAATAAGTGATCTCAGG + Intergenic
923412864 1:233726931-233726953 GTAAACCAACCAGCAATCTCTGG - Intergenic
923598600 1:235381221-235381243 GTGAACCAACTGGTGATCTCTGG - Intronic
923601917 1:235411176-235411198 GTGAACCAACCAGTGATCTCTGG - Intronic
923788323 1:237089786-237089808 GTGAATTTTTAAGTAATCTCTGG + Intronic
924522879 1:244820686-244820708 GTGAACCAACCAGTGATCTCTGG + Intergenic
1063308451 10:4930058-4930080 ATGAACCAACCAGTGATCTCTGG + Intronic
1063318222 10:5027424-5027446 ATGAACCAACCAGTGATCTCTGG - Intronic
1064175389 10:13070953-13070975 GTGAACCAAACAGCAATCTCTGG + Intronic
1064900010 10:20285618-20285640 GTGAACTAGAAAGTATTCTTAGG - Exonic
1067822744 10:49544350-49544372 GCCAACTAACCAGTGATCTCTGG - Intergenic
1068907296 10:62340879-62340901 GTTAACCAACCAGTGATCTCTGG - Intergenic
1070974616 10:80596421-80596443 GTGTACTGATAAGGAATCTCAGG + Intronic
1071926378 10:90414816-90414838 GTGAACCAACCAGCAATCTCTGG + Intergenic
1073574509 10:104611411-104611433 GTGAACCAACCAGTAATCCCTGG + Intergenic
1074685014 10:115953499-115953521 GTGAGAGAACAAATAATCTCAGG - Intergenic
1075265236 10:120995481-120995503 GTGAACTAACCAGTGGTCTCTGG + Intergenic
1080058223 11:27929538-27929560 GTGAAACAACCAGTAATCTCTGG - Intergenic
1080288540 11:30644311-30644333 GTGAAGTAATCAGTGATCTCTGG + Intergenic
1083001299 11:59293427-59293449 GTGAACCAACCAGTGGTCTCTGG - Intergenic
1083049375 11:59763308-59763330 GTACACTAACAAGGAATCTGTGG - Intronic
1084735984 11:71105752-71105774 GTGAACTCTCATGTAAGCTCCGG + Intronic
1084875139 11:72125601-72125623 GTGAACCAACTAGTGATCTCTGG - Intronic
1085566883 11:77521874-77521896 GTGAACCATCCAGCAATCTCTGG - Intronic
1085619820 11:78029466-78029488 GTGAACCAACCAGTGACCTCTGG - Intronic
1086469126 11:87087434-87087456 GTGAACCAGCCAGTGATCTCTGG - Intronic
1088059138 11:105624371-105624393 GTGAACTAGCAAGCACACTCAGG + Intronic
1088628852 11:111754269-111754291 GTTACCTAACAAGTAGTCTGAGG - Intronic
1088755252 11:112880407-112880429 ATGATCTAAGAAGTACTCTCTGG + Intergenic
1090455774 11:126848469-126848491 GTAAACCAACCAGTAATCTCAGG + Intronic
1093735757 12:22618504-22618526 GTAAACCAACCAGTGATCTCTGG + Intergenic
1094315467 12:29134350-29134372 GTGAACCAACCAGTGGTCTCTGG - Intergenic
1095386920 12:41661428-41661450 GAGAAGAAACAAGAAATCTCGGG + Intergenic
1097133501 12:56831726-56831748 GTGAACCAACCAGTGGTCTCTGG - Intergenic
1097338692 12:58413413-58413435 GTAAACCAACCAGTGATCTCTGG - Intergenic
1097493631 12:60300681-60300703 GTGAACCAACCACTGATCTCTGG + Intergenic
1097844279 12:64351024-64351046 GTGAACCAACCAGCAACCTCTGG + Intronic
1098436299 12:70471606-70471628 GTGAACCAATCAGCAATCTCTGG + Intergenic
1098438030 12:70488880-70488902 GTGAACCAATCAGTGATCTCTGG - Intergenic
1099535054 12:83833080-83833102 GTGAACCAACCAGCAATCTCTGG - Intergenic
1100629579 12:96374339-96374361 GTTAAGTAAAAATTAATCTCTGG + Intronic
1103471764 12:121187582-121187604 GTGAAATTACAAATAATCACTGG + Exonic
1103607153 12:122095762-122095784 GAGAACTGACAAGTTATCTCTGG - Intronic
1107311739 13:39085891-39085913 ATGAACCAACCAGTGATCTCTGG + Intergenic
1107458162 13:40574653-40574675 CTGAACCAACATGTAGTCTCTGG + Intronic
1108204022 13:48070623-48070645 GTGAACTAACCAGAAATCTCTGG + Intronic
1109240649 13:59883090-59883112 ATGAACTAACAAGTATTGACTGG + Intronic
1109745275 13:66616541-66616563 GTGAAGCAACCAGCAATCTCTGG + Intronic
1111079146 13:83279336-83279358 GTAAACCAACCAGTGATCTCTGG + Intergenic
1111132802 13:83998846-83998868 GTGAACCAACCAGCAATCTCTGG + Intergenic
1112549412 13:100405338-100405360 GTAAACCAACCAGCAATCTCTGG - Intronic
1114565236 14:23627000-23627022 GTGAACCAACCAGTGATCTCTGG + Intergenic
1114982714 14:28186318-28186340 GTGAACCAACCAGTGATCTCTGG + Intergenic
1116390083 14:44381003-44381025 GTGAACCAACCAGCAATCCCTGG - Intergenic
1117420152 14:55536647-55536669 GTGAATGAATAAATAATCTCTGG + Intergenic
1119822626 14:77630930-77630952 ATGAACCAACCAGTGATCTCTGG - Intergenic
1120402254 14:84046949-84046971 GTAAACTAATCATTAATCTCTGG - Intergenic
1121004035 14:90476237-90476259 GTGAACCAACCAGTGATCTCTGG + Intergenic
1122591717 14:102857210-102857232 GTGAACCAATCAGTGATCTCTGG - Intronic
1123193575 14:106594953-106594975 GTGAACCAACCAATGATCTCTGG + Intergenic
1123202203 14:106677173-106677195 GTGAACGAACCAATGATCTCTGG + Intergenic
1123768424 15:23504630-23504652 GTGAACCAACCAGCAATCTCTGG - Intergenic
1125062400 15:35440082-35440104 GTGAACCAACCAGCAATCTCTGG + Intronic
1126253481 15:46596532-46596554 ATGAACTAACAATTAATGTAAGG + Intergenic
1126419103 15:48452868-48452890 GTGAATTAACAAATAAACTGTGG + Intronic
1126427464 15:48544769-48544791 GTGAAGGAACAAATAATATCAGG - Intronic
1129535837 15:76313059-76313081 CTGAACTAACAAGCACTCTAAGG + Intergenic
1129609606 15:77042813-77042835 TTCAACTAATAAGAAATCTCTGG - Exonic
1131837345 15:96404259-96404281 ATGAACTAAAAATTAATGTCAGG + Intergenic
1135036423 16:19081860-19081882 GTGAACCAACCAGTGATCTCTGG + Intergenic
1136870281 16:33800816-33800838 GTGAACCAACCAATGATCTCTGG - Intergenic
1138257149 16:55575772-55575794 CTGAAATAAAAAGTAAACTCAGG - Intronic
1139202058 16:64987920-64987942 AAGAACTAACTAGCAATCTCAGG + Intronic
1139204864 16:65017773-65017795 GTGAACCAACTAGTGATCTCTGG - Intronic
1139736918 16:68998266-68998288 GTGAACCAACCAGTGATCTCTGG - Intronic
1140002060 16:71036058-71036080 GTGAACCAACAAGGAAACTTTGG - Intronic
1140067274 16:71622203-71622225 GTGAACTAATAAGAAAACCCAGG + Intergenic
1203101890 16_KI270728v1_random:1315238-1315260 GTGAACCAACCAATGATCTCTGG + Intergenic
1144555256 17:16276363-16276385 GAGAACCAACCAGTGATCTCTGG - Intronic
1146825272 17:36017117-36017139 GTGATCTACCAAGTTATCTAAGG + Intronic
1149483771 17:57024952-57024974 GTGAACCAACCAGTGAGCTCTGG - Intergenic
1152213313 17:79016694-79016716 GTGAACCAACCAGTGATCTCTGG + Intergenic
1153349481 18:4062849-4062871 GTGAACCAACCAGTGATCACTGG + Intronic
1153745782 18:8178216-8178238 GTGAACAAACCAATGATCTCTGG - Intronic
1155784677 18:29881290-29881312 GTGAACCATCCAGCAATCTCTGG - Intergenic
1156698613 18:39796882-39796904 GTGAACCAACCAGCAATCTCTGG - Intergenic
1157821997 18:50778917-50778939 GTGAACCTACCAGCAATCTCTGG + Intergenic
1159479691 18:68972761-68972783 TTTAATTAACAAGTAATTTCCGG + Intronic
1160607262 18:80060670-80060692 GTGAACCAACCAGTGAACTCTGG - Intronic
1166401939 19:42488197-42488219 GTGAACCAACCAGTGATCTCTGG - Intergenic
1166900703 19:46059520-46059542 GTGAGCCAACCAGTGATCTCTGG - Intronic
925027345 2:620393-620415 GTGAAATTACAAGGAATCTGGGG + Intergenic
926927371 2:18001392-18001414 GTGAACTTACCAGTGATCTCTGG + Intronic
929663973 2:43819182-43819204 GGGATCTAGTAAGTAATCTCTGG - Intronic
930150266 2:48052065-48052087 GTGAACCAACCAGTGATCTCTGG - Intergenic
930312319 2:49757014-49757036 CTTAACAAACAAGAAATCTCAGG - Intergenic
931243529 2:60474022-60474044 GTGAAGTATCAAGGAATCTAAGG - Intronic
932196787 2:69790771-69790793 GTCAACCAACCAGGAATCTCTGG - Intronic
933131089 2:78674524-78674546 ATGAACCAACCAGCAATCTCTGG - Intergenic
934104741 2:88685428-88685450 GTGAACCAGCTAGTGATCTCTGG + Intergenic
934931978 2:98434199-98434221 GTGAACCAACCAGCAATCTCTGG + Intergenic
935377358 2:102413207-102413229 GTGAAACAACCAGTGATCTCTGG + Intergenic
935471885 2:103470523-103470545 GTGAACCAACCAGTGATCTCTGG - Intergenic
936839928 2:116757252-116757274 GTGAACCTACCAGCAATCTCCGG + Intergenic
938692442 2:133804718-133804740 GAGAACTAACAAATACACTCGGG - Intergenic
942097314 2:172546409-172546431 GTGAACTAACCAGTGATCTCTGG + Intergenic
942839221 2:180339676-180339698 GTGAACCAACCAGCAATCTCTGG + Intergenic
943120272 2:183726389-183726411 GTGAAAGAAAAATTAATCTCAGG - Intergenic
943466857 2:188239224-188239246 GTGAACCAACCAGTGATTTCTGG + Intergenic
945370088 2:209005832-209005854 GTGAACCAACCAGTGATCTCTGG + Intergenic
946297358 2:218795636-218795658 GTGAACCAACCAGCAATCTTTGG - Intronic
947197002 2:227578302-227578324 GTTAACTAAAAAGTATTCCCTGG - Intergenic
947305058 2:228736500-228736522 GTGAACTAGAAAATACTCTCAGG + Intergenic
1169389875 20:5181241-5181263 GTGAACCAACCAGTGATCTCTGG - Intronic
1169429127 20:5520897-5520919 GTGAACCAACCAGTGATCTCTGG + Intergenic
1172922108 20:38492635-38492657 GTGAACTAAAAAGTAAATACAGG - Intronic
1175180898 20:57146725-57146747 CTCAACTAACCAGAAATCTCTGG + Intergenic
1177414631 21:20777746-20777768 GTGAGCCAACCAGTGATCTCTGG - Intergenic
1177737528 21:25110422-25110444 CTCGACTAACAAGTAATCTATGG - Intergenic
1178541057 21:33450800-33450822 GTGACTTAAGAAGTGATCTCAGG + Exonic
1182188644 22:28435350-28435372 GTGGACTAACAAGAAAGTTCAGG + Intronic
952124167 3:30280034-30280056 GTGAACCAACCAGTGATCTCTGG + Intergenic
952193215 3:31045988-31046010 GTGAACCTACTAGCAATCTCTGG + Intergenic
952637228 3:35546534-35546556 GTTAACCAACCAGCAATCTCCGG - Intergenic
953153894 3:40351399-40351421 GTGAACAAATCAGTGATCTCTGG + Intergenic
953441221 3:42919137-42919159 GTGAACCAACCAGCAATCTCTGG - Intronic
954597874 3:51842274-51842296 GTGAACCAACCAGCAATCTCCGG - Intergenic
955531624 3:59879133-59879155 GTGATGTAATCAGTAATCTCTGG - Intronic
957709197 3:83832882-83832904 ATGCAATAACAAGTAATCTGTGG + Intergenic
958592372 3:96174615-96174637 CTGAACCAACCAGTGATCTCTGG + Intergenic
958744171 3:98113122-98113144 GTGAACCAACCAGCAATCTCTGG + Intergenic
959604187 3:108224043-108224065 GTTAACTAACAAGCAAACTGGGG + Intergenic
960038743 3:113127888-113127910 GTGAACTTAAGAGAAATCTCAGG - Intergenic
960709193 3:120510735-120510757 GTGAACCAGCCAGTGATCTCTGG + Intergenic
961510502 3:127398927-127398949 GTGAACTAACCAGTGATCTTTGG - Intergenic
963251696 3:143109865-143109887 GTGAACCAACCAGTGATCTCCGG + Intergenic
967531256 3:190550718-190550740 GTGAACCAACCAGCAATCTCTGG - Intronic
969634933 4:8363095-8363117 GTGAACCAACCAGTGATCTCTGG + Intergenic
972015964 4:34246461-34246483 GATAACTTACAATTAATCTCTGG + Intergenic
973028729 4:45308767-45308789 GTGATCAGACAAGTACTCTCCGG - Intergenic
973951761 4:56022575-56022597 CTGAACTAATTAGAAATCTCAGG + Intronic
974072497 4:57137077-57137099 GTGAATCAACCAGTGATCTCTGG - Intergenic
974081259 4:57215668-57215690 TTGAATTAAGAAGGAATCTCTGG - Intergenic
974203929 4:58675058-58675080 GTGAACCAAACTGTAATCTCTGG + Intergenic
974295667 4:59995373-59995395 GTGAACCAACCAGTGATCTCTGG - Intergenic
974665551 4:64956768-64956790 GTGAACTAACCAGCACTCTCTGG + Intergenic
974675014 4:65078297-65078319 GTGAACATACTAGCAATCTCTGG + Intergenic
974922920 4:68264528-68264550 GTGAACCAACCAGTGATTTCTGG + Intergenic
976602049 4:86946753-86946775 GTCAACAAACAAGTGAACTCAGG + Intronic
977205663 4:94162422-94162444 ATGGAAAAACAAGTAATCTCTGG + Intergenic
977576301 4:98677772-98677794 GTGATCTAACCAGTAACTTCAGG - Intergenic
977592827 4:98845429-98845451 GTGAACCGACAAGTGATCTCTGG - Intergenic
977673937 4:99727167-99727189 GTAAACCAACCAGTGATCTCTGG - Intergenic
978926738 4:114254707-114254729 GAAAACTAACAAAAAATCTCTGG + Intergenic
979483815 4:121248169-121248191 GTGATCTCTCATGTAATCTCAGG - Intergenic
979773794 4:124562289-124562311 GTGAACCAACTAGTGATCTCTGG + Intergenic
980446420 4:132914619-132914641 ATGAAATAAAAACTAATCTCTGG - Intergenic
981324340 4:143428614-143428636 GTGAACCAACCAGCAATCTCTGG - Intronic
981525802 4:145706026-145706048 GTGAACCAACCAGTGATCTCTGG - Intronic
983262421 4:165471283-165471305 GTGAACCAACCAGTGATCTCTGG - Intronic
983773604 4:171578937-171578959 GTCAACCAACCAGTGATCTCTGG - Intergenic
984400532 4:179257983-179258005 GTGAACCAACCAGTGATCTCTGG - Intergenic
986213624 5:5697952-5697974 GTGAACCTACCAGCAATCTCTGG + Intergenic
988157650 5:27476106-27476128 GTGAACCAACCAACAATCTCTGG + Intergenic
988295440 5:29354352-29354374 GTGAACCAATCAGTGATCTCTGG + Intergenic
988361195 5:30238966-30238988 GTGAACCAACCAGTGATCTCTGG + Intergenic
988569196 5:32347403-32347425 GTGAACCAACCAGTGATCTTTGG + Intergenic
988899760 5:35719197-35719219 GTGAACCAACCAGCAATTTCTGG - Intronic
989692142 5:44157614-44157636 GTGAACCAACCAGCAATCCCTGG + Intergenic
989742180 5:44786157-44786179 GTGCACCAACCAGTGATCTCTGG - Intergenic
990629007 5:57647324-57647346 GAAAACTAACAAGGAAACTCTGG - Intergenic
990692711 5:58381687-58381709 ATGAACCAACCAGTGATCTCTGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992955548 5:81904751-81904773 GAGAAGTAACAATTAGTCTCAGG + Intergenic
994360111 5:98840407-98840429 GTGAACCAACCAGCAATCTCCGG - Intergenic
995320604 5:110829798-110829820 GTGAACCAATCAGTGATCTCTGG + Intergenic
996574408 5:124966069-124966091 GTGAACCTACCAGTAATTTCTGG + Intergenic
996611440 5:125384979-125385001 GTGACCTAAAAAATAATTTCTGG - Intergenic
1000740993 5:164969633-164969655 GTGAACCAACCAGCGATCTCTGG - Intergenic
1004113349 6:12743136-12743158 GTGAACTAACAAGTAATCTCTGG - Intronic
1004243247 6:13947204-13947226 GTGAACCAACCAGTGATCTCTGG - Intronic
1004432790 6:15561147-15561169 GTGAACCAACCAGTGACCTCTGG + Intronic
1005465472 6:26108444-26108466 GTAAATTAATAAGTAATCTTTGG + Intergenic
1008291217 6:49718088-49718110 GTGAACCAACCAGCAATCTCTGG - Intergenic
1009034883 6:58105222-58105244 ATGAACTAGAAAGTAATATCTGG - Intergenic
1009210399 6:60855945-60855967 ATGAACTAGAAAGTAATATCCGG - Intergenic
1009609632 6:65924000-65924022 GTGAACCAGCAAATACTCTCTGG + Intergenic
1009735397 6:67670321-67670343 GTGAACCAACCAGTGATCTCTGG - Intergenic
1010453518 6:76029572-76029594 GTGAACCAACCAGCAATCTCTGG + Intronic
1010718607 6:79258187-79258209 GTGAACCAACCAGTGATCTCTGG - Intergenic
1010810198 6:80291678-80291700 GTGAACCAACCAGTGATCTCTGG - Intronic
1010927479 6:81761076-81761098 GTGAAAGAACAAATAATCTAGGG - Intergenic
1010984330 6:82405177-82405199 GCTAAAAAACAAGTAATCTCAGG - Intergenic
1011590999 6:88970954-88970976 GTGAACCAACCAGCAATCTCTGG + Intergenic
1012438713 6:99241959-99241981 CTGTACTAACAAGGATTCTCAGG + Intergenic
1012693975 6:102354266-102354288 GTGAACCAACCAGCAATCTCTGG - Intergenic
1014097291 6:117474301-117474323 GTGAACCAACAAGTGATCTCTGG - Intronic
1015270335 6:131331769-131331791 GTGAATCAACCAGTGATCTCTGG + Intergenic
1015813214 6:137181436-137181458 GTGAACTAACCAGTGATCTCTGG - Intergenic
1016162158 6:140895143-140895165 GTGAACCAACCAGCAATCTCTGG - Intergenic
1020596364 7:10212527-10212549 GTGAACCAACCAGTGATCTCTGG - Intergenic
1020956406 7:14744878-14744900 GTGAACCAACCAGCAATTTCTGG + Intronic
1021512761 7:21452037-21452059 GTGAACCAACCAGTGATCTCTGG - Intronic
1024147082 7:46528550-46528572 GTGAAACAACCAGTGATCTCTGG + Intergenic
1024437894 7:49380875-49380897 GAGAACCAACCAGAAATCTCTGG + Intergenic
1027420150 7:78011038-78011060 GTAAACCAACCAGTGATCTCTGG + Intergenic
1032251316 7:130260438-130260460 GTGAACTAACCAGAAATCCCTGG + Intergenic
1033161902 7:139005239-139005261 GTGAACCAACTAGCGATCTCTGG + Intergenic
1033865991 7:145691275-145691297 GTGAACCAACCAGCAAACTCTGG + Intergenic
1034250091 7:149682825-149682847 GTGAACCAATCAGTGATCTCTGG - Intergenic
1034921706 7:155088511-155088533 GTGACCTAACAAGCAATCCCCGG + Intergenic
1036195897 8:6714488-6714510 GTGAACAAACCAGTTATTTCAGG + Intronic
1037111365 8:15167805-15167827 GTGAACCAACCAGCAACCTCTGG + Intronic
1037988201 8:23302774-23302796 GTGCACTAACAGGTGATCACAGG + Intronic
1040758295 8:50807706-50807728 GTGAACCAATCAGCAATCTCTGG + Intergenic
1041228459 8:55724669-55724691 GTGAACCAACCAGTGATCTCTGG - Intronic
1041393759 8:57371759-57371781 GTGAACCAACCAGTGATCTCTGG + Intergenic
1041810128 8:61899324-61899346 GTGAACCAACCAGTGATCACTGG - Intergenic
1042343885 8:67708458-67708480 TTGAACTAACTAGTGATCTCTGG + Intronic
1042415213 8:68510484-68510506 GTGAACCAACCAGCAATCTCTGG - Intronic
1043405349 8:79926717-79926739 GTAAACTACAGAGTAATCTCTGG - Intronic
1046387811 8:113526226-113526248 GTGAACCAACCAGTGATCTCTGG + Intergenic
1046953350 8:120038987-120039009 GTGACCTAAGAAGTAGTCTGGGG + Intronic
1047390233 8:124444599-124444621 GTGAACCAACCAGTGATATCTGG - Intergenic
1047581369 8:126219329-126219351 ATGAACCAACCAGTGATCTCTGG - Intergenic
1048175951 8:132153111-132153133 GTGAACCAACCAGCAATCTCTGG + Intronic
1050508797 9:6372867-6372889 GTGAACCAACCAGCAATCCCTGG - Intergenic
1051225559 9:14895423-14895445 GTGAACCAACCAGTGATCTTTGG + Intronic
1051772451 9:20593669-20593691 GTGAACCAACCAGTGATCTCTGG + Intronic
1051786250 9:20747057-20747079 TTGAACTAATAAGCAATCTGTGG + Intronic
1051804824 9:20980700-20980722 GTGATCTAAAAAGTAAAATCTGG - Intronic
1052352821 9:27474423-27474445 AGGAATTAAAAAGTAATCTCTGG - Intronic
1053234946 9:36444956-36444978 GTGGATTAACCAGAAATCTCTGG - Intronic
1053536441 9:38931183-38931205 GTGAAAGAAAAACTAATCTCGGG - Intergenic
1054629693 9:67432765-67432787 GTGAAAGAAAAACTAATCTCGGG + Intergenic
1054796254 9:69305068-69305090 GTGAACCAACCAGTGATCTCTGG - Intergenic
1055207367 9:73749208-73749230 GAAAACTAACAAGGAAACTCTGG - Intergenic
1056050258 9:82761191-82761213 GTGACTTAAAAAGTCATCTCTGG - Intergenic
1058016072 9:100033732-100033754 GTGAATCAACCAGTCATCTCTGG + Intronic
1058282129 9:103128523-103128545 GTGAAGGAACCAGCAATCTCTGG - Intergenic
1203761342 EBV:13978-14000 GTGCAGTAACAGGTAATCTCTGG + Intergenic
1203762271 EBV:17050-17072 GTGCAGTAACAGGTAATCTCTGG + Intergenic
1203763200 EBV:20122-20144 GTGCAGTAACAGGTAATCTCTGG + Intergenic
1203764129 EBV:23194-23216 GTGCAGTAACAGGTAATCTCTGG + Intergenic
1203765058 EBV:26266-26288 GTGCAGTAACAGGTAATCTCTGG + Intergenic
1203765987 EBV:29338-29360 GTGCAGTAACAGGTAATCTCTGG + Intergenic
1203766916 EBV:32410-32432 GTGCAGTAACAGGTAATCTCTGG + Intergenic
1188133795 X:26469721-26469743 GTGAACCAACCAGTGATCTCTGG - Intergenic
1188251851 X:27905824-27905846 GGGAACGCACAAGCAATCTCTGG + Intergenic
1188763116 X:34056842-34056864 GTGAACCAACCAGCAATCTCTGG + Intergenic
1189006193 X:36998258-36998280 GTGAACCAACCAGCAATCTCTGG + Intergenic
1189042399 X:37555547-37555569 GTGAACCAACCAGCAATCTCTGG - Intronic
1189072909 X:37883687-37883709 GTGAACCAACCAGTGATCTCTGG - Intronic
1189153256 X:38729353-38729375 GTGAACCAACCAGTAATTTCTGG + Intergenic
1189616638 X:42790454-42790476 GTGAACCAACCAGCAAACTCTGG - Intergenic
1190154269 X:47975029-47975051 GTGAATTCATAAGTTATCTCTGG - Exonic
1190549035 X:51559554-51559576 GTGAACCAACTAGCAATCTCTGG - Intergenic
1191189778 X:57654669-57654691 GTAAACCAACCAGCAATCTCTGG + Intergenic
1191644787 X:63468193-63468215 GTGAACCAATCAGCAATCTCTGG - Intergenic
1191822931 X:65332642-65332664 GTGAACCAACCAGTCATCTCTGG - Intergenic
1192064595 X:67868226-67868248 GAAAACTAACAATGAATCTCTGG - Intergenic
1193269625 X:79514408-79514430 GTGAACCAACCAGCAATCTCTGG + Intergenic
1193330867 X:80233975-80233997 GTGAACTAACTGGTGAACTCTGG - Intergenic
1193485566 X:82081661-82081683 GTGAACCAACTAATGATCTCTGG - Intergenic
1194159533 X:90433458-90433480 GTGAACCAACCAGTGATCTCTGG - Intergenic
1194171869 X:90596319-90596341 GAAAACTAACAAATAAACTCTGG - Intergenic
1194476499 X:94365651-94365673 GTGAAAGAAAAATTAATCTCAGG + Intergenic
1194809954 X:98376970-98376992 GTGAACCAACCAGCAATCTCCGG - Intergenic
1194850753 X:98865589-98865611 CTGAACCAACCAGTGATCTCTGG + Intergenic
1195877252 X:109554924-109554946 GTGAACCAACCAGTGATCTCTGG + Intergenic
1196313840 X:114199439-114199461 GTCAACTAGCAAGTAATGACTGG - Intergenic
1197066385 X:122238243-122238265 GTGAACCAACCAGAAAACTCTGG + Intergenic
1197365893 X:125563974-125563996 GTGAACCAACCAGCAATCTCTGG - Intergenic
1197509700 X:127355737-127355759 GTGAACCAACCAGCGATCTCTGG + Intergenic
1197738879 X:129873913-129873935 GTGAACCAACCAGTGATCTCTGG + Intergenic
1198181637 X:134215633-134215655 GTGAACCAACCAGTGATCTCTGG - Intergenic
1198847079 X:140923832-140923854 GTGAACCAACCAGTGATCTCTGG - Intergenic
1200505834 Y:4010428-4010450 GTGAACCAACCAGTGATCTCTGG - Intergenic
1201320634 Y:12694402-12694424 GTGAACCAACCAGTGATCTTTGG - Intergenic
1201324841 Y:12745006-12745028 GTAAACTAACCAGCCATCTCTGG - Intronic
1201344617 Y:12968705-12968727 GTGAACCAGCCAGTGATCTCTGG - Intergenic