ID: 1004113927

View in Genome Browser
Species Human (GRCh38)
Location 6:12749055-12749077
Sequence CTCCATGACCAGCGGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004113914_1004113927 24 Left 1004113914 6:12749008-12749030 CCTGGCAGTAAGGGAGTAGAGAG 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1004113927 6:12749055-12749077 CTCCATGACCAGCGGGACCAGGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004113927 Original CRISPR CTCCATGACCAGCGGGACCA GGG Intronic
901649409 1:10735014-10735036 CCCCATGACCAACGGGACCCTGG + Intronic
901654840 1:10763228-10763250 CTCTGTGACCAGCGGCTCCATGG + Intronic
903384657 1:22918457-22918479 CTCCAGGACTAGGGTGACCAGGG - Intergenic
904383036 1:30124361-30124383 CTCCCCCACCAGCTGGACCAGGG - Intergenic
904415719 1:30360043-30360065 CTGCATGACCAGAGGCTCCAGGG - Intergenic
909301478 1:74018086-74018108 CTCCATGTCCAGTGTGACTAAGG - Intergenic
912656412 1:111489877-111489899 CACCATGTCCAGCTTGACCATGG + Intronic
915728411 1:158035392-158035414 CTCCATCAGCAGAGGGTCCAGGG + Intronic
920567036 1:206982322-206982344 CTCCATGGCTAGAGTGACCAGGG + Intergenic
920930298 1:210381783-210381805 CTCCAAAAACAGTGGGACCAGGG + Intronic
924147268 1:241089193-241089215 CTCCATGACCAGAGTTGCCATGG + Intronic
1063381588 10:5589284-5589306 CTCCAGGACCAGCGGTGCCTGGG - Intergenic
1072542221 10:96406808-96406830 CTCCTTGACCATCGGGGCAATGG - Intronic
1075793668 10:125103747-125103769 TGCCATGACCAGCTGAACCAAGG + Intronic
1076431077 10:130402742-130402764 CACCATGACCAGAGAGACCTGGG - Intergenic
1085321041 11:75574180-75574202 CTCCATGAAGAGAGGGTCCATGG + Intergenic
1085479285 11:76808096-76808118 CTCCATGACAGCAGGGACCAAGG - Intergenic
1089290210 11:117433163-117433185 CTCGATGAGCAGCTGGACCCTGG + Exonic
1091217929 11:133914910-133914932 CTCCATGACCAAAGGGCCCCAGG - Intronic
1092145270 12:6210381-6210403 CTATATGACCAGTGGAACCAAGG + Intronic
1095983697 12:47986398-47986420 CTTCTTCACCAGCGGGTCCAGGG + Exonic
1095985605 12:47997608-47997630 CACCAAGACCAGGGGGACCAGGG + Exonic
1099398584 12:82172860-82172882 CTCTCTGAGCAGCAGGACCAAGG + Intergenic
1103321453 12:120094918-120094940 CTCCATGAACAGGTGGGCCAGGG - Intergenic
1107320030 13:39176810-39176832 CTCCCTCACTAGCAGGACCACGG - Intergenic
1111314279 13:86532301-86532323 CTCCTTTACCATCAGGACCACGG - Intergenic
1114463201 14:22901540-22901562 GTCCATTTCCAGTGGGACCATGG + Exonic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1121098534 14:91234099-91234121 CTCCAGGACCGGCCGGGCCAGGG - Exonic
1122745349 14:103894386-103894408 CTTCATGCCCAGCGGGCCCGGGG + Intergenic
1124609803 15:31200771-31200793 CTCCTTGACAAGCTGGGCCATGG - Intergenic
1126171711 15:45700775-45700797 CTCCAGGCCCAGCAGGACAAAGG - Intergenic
1127064250 15:55221026-55221048 CTCCATAACCATCGTGACCTGGG + Intronic
1132566849 16:627499-627521 CTCCCTGGCCAGCGGGGCCGGGG + Exonic
1132577535 16:670911-670933 CTCCAGGGCCTGCGGGGCCAGGG - Exonic
1134856937 16:17527880-17527902 CTCCATGAGAATAGGGACCAAGG + Intergenic
1137609516 16:49809516-49809538 TTCCAGGACCAGCAGGACCTGGG - Intronic
1138370377 16:56521798-56521820 CTCCCTGACCAGCGGTGCCATGG + Intergenic
1142295405 16:89218155-89218177 CTCCAAGACCAGCGGGACAACGG - Intronic
1144862170 17:18311940-18311962 CTCCATGACAACAGGGGCCAGGG - Intronic
1147772515 17:42877796-42877818 GTTCAAGACCAGCCGGACCAGGG + Intergenic
1148133122 17:45274226-45274248 CTCCTTGACCAGCTGGCCCAGGG + Exonic
1148794806 17:50191823-50191845 CTCGGGGACCAGCAGGACCAGGG + Exonic
1148794949 17:50192501-50192523 CTGGAGGACCAGCAGGACCAGGG + Exonic
1148845804 17:50529139-50529161 CCCCATGACCAGGGGGTCTATGG - Exonic
1150149265 17:62795824-62795846 CTCCAGGTCCAGTGTGACCAGGG - Intronic
1151718397 17:75842980-75843002 CTCCTTGCCCAGGGGGACCCTGG + Intronic
1152824996 17:82458960-82458982 CTCCACGCCGAGCGGGCCCAGGG - Intronic
1153636533 18:7117804-7117826 CTCCAGGAGCGGCGGGGCCAGGG - Exonic
1159844121 18:73438272-73438294 CACCATGAACAGCAGGAGCAGGG - Intergenic
1160825344 19:1077728-1077750 CTGCATGCCCAGCTGGGCCATGG + Intronic
1161232243 19:3180121-3180143 CTCCTTGTCCAGGGTGACCATGG - Exonic
1167013886 19:46826980-46827002 CTCCATCACCATAGGGGCCAGGG + Intergenic
927710587 2:25323304-25323326 CTCCAGGAACAGCAAGACCAGGG - Intronic
930722044 2:54647217-54647239 CTCCAAGACCAGCCGGGCCCTGG + Exonic
932231589 2:70087998-70088020 CTCCATGACCAACAGTACCGCGG + Exonic
934080547 2:88464080-88464102 CTGCATGACCCAGGGGACCAAGG + Intergenic
934556963 2:95292544-95292566 CTCCAGGGCCACCAGGACCAGGG - Intergenic
935963390 2:108449013-108449035 CTCCGTGACCTGCAGGCCCAGGG + Exonic
938261491 2:129898813-129898835 ATCCATGACCAGAGGAACCTCGG + Intergenic
938444130 2:131364034-131364056 CTCCAAGACCTGCGGGAGAAAGG + Intergenic
940510221 2:154604461-154604483 CTCAATGCCCAGGGTGACCAAGG + Intergenic
946381676 2:219353086-219353108 CCCCATGACCAGGGTGAGCAGGG - Intergenic
947531270 2:230910027-230910049 CTGCAGGACCAGCTGGACCCTGG + Exonic
948265554 2:236633030-236633052 CTCCATGACCACCGGAACACTGG - Intergenic
948660863 2:239505764-239505786 CCCCATGCCCAGGGTGACCATGG + Intergenic
948909724 2:240996962-240996984 CTCCCTGACCAGGGAGGCCAGGG + Intergenic
1170571235 20:17634004-17634026 CTCACTGGCCAGCTGGACCAGGG + Intronic
1170608118 20:17888965-17888987 CTCCATGACCACCAGGGCAACGG + Intergenic
1172288363 20:33757246-33757268 CCCCATGACCAGCGCCACCGGGG + Exonic
1173800726 20:45892837-45892859 CTGCATGACCAGCACGGCCAGGG - Exonic
1173864109 20:46303252-46303274 CTCCATGCCAAGGGGTACCAAGG - Intronic
1174164405 20:48574631-48574653 CTCCAAAAGCAGCTGGACCAAGG + Intergenic
1175869010 20:62198638-62198660 CTCCTTCACCAGCGTGCCCACGG - Exonic
1179792175 21:43762105-43762127 CTCCCTCAGCAGGGGGACCACGG - Exonic
1180612886 22:17109120-17109142 CTCCCCGACCAGCGGGTCTATGG - Exonic
1183457684 22:37931680-37931702 CTCCAGGGCCAGCAGGACCCAGG - Intronic
1183676056 22:39299462-39299484 ACCCATGCCCAGTGGGACCAAGG - Intergenic
1184429033 22:44430451-44430473 CTCCATGGGCAGCGGGACCCTGG - Intergenic
1184728163 22:46358033-46358055 CTCCATGCCCAGCTGGGCCGAGG - Intergenic
958593496 3:96190521-96190543 CTCCATGACCAGCTCACCCATGG + Intergenic
967491330 3:190094551-190094573 CTCCATAACCATTGGGACAATGG + Intronic
968742703 4:2339584-2339606 CTCCTTGGCCAGCGGGCGCATGG + Exonic
969587857 4:8104753-8104775 CTCCAGGGCCAGCGGCACCAGGG + Intronic
970698733 4:18709686-18709708 TGACATGACCAGTGGGACCAGGG - Intergenic
982135478 4:152270783-152270805 CTCCATGAACAATGGGACTATGG + Intergenic
983653545 4:170056989-170057011 GACCATGACCAGGGAGACCATGG + Intergenic
991612265 5:68461881-68461903 CTCCATGAGGACAGGGACCATGG - Intergenic
992415308 5:76546989-76547011 CTCCACTACCAGCTGTACCAAGG - Intronic
993777177 5:92013637-92013659 AGCCATGACCAGCGGGCCAAGGG + Intergenic
996884921 5:128343014-128343036 CACCATGCCCAGCGGGATAAAGG + Intronic
997665649 5:135627805-135627827 CTCCATGACAGGAGTGACCATGG - Intergenic
1003566914 6:7229910-7229932 CTCCATGCTCAGCGGCAGCAGGG - Exonic
1004113927 6:12749055-12749077 CTCCATGACCAGCGGGACCAGGG + Intronic
1007405579 6:41634408-41634430 CTCCATCACCAGGGGTAGCAGGG + Intergenic
1010252887 6:73726891-73726913 CTCCTTGACCAGAGGGCACAGGG - Intronic
1019186438 6:170223327-170223349 CTCCATGGGCATGGGGACCAGGG - Intergenic
1019452475 7:1106922-1106944 CTCCCTGCCCACCGTGACCACGG + Intronic
1019539496 7:1545427-1545449 CACCAGGAACAGCGGGACCTGGG - Exonic
1019606656 7:1913514-1913536 CTCCAGGACCTGGGGGAGCAAGG - Intronic
1020181817 7:5928536-5928558 TTCCATGACCACCTGGAACAAGG + Intronic
1020301118 7:6796404-6796426 TTCCATGACCACCTGGAACAAGG - Intronic
1023688817 7:42764818-42764840 CTCCATGACCAGCGGGCTTTTGG + Intergenic
1028754100 7:94415249-94415271 CTCTTGGACCAGCAGGACCAGGG - Exonic
1034255187 7:149720868-149720890 CTCCTTCACCAGCTGCACCAGGG - Exonic
1034901755 7:154912032-154912054 CTCAATGACCAGCAGGACAGCGG + Intergenic
1034929878 7:155153317-155153339 CTCCATGACCAGCAAGATCATGG - Intergenic
1035021346 7:155802915-155802937 CGCCATGCCCAGCGGGTGCAGGG + Exonic
1036207516 8:6815910-6815932 CAGCATGACCTGCGGGACCCAGG + Exonic
1044925825 8:97208075-97208097 CTCCATTTCCAGTGGGGCCAAGG - Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049796701 8:144500359-144500381 CTCCATGCCCCCCTGGACCACGG + Exonic
1050413320 9:5388652-5388674 CTCCATGACCTTTAGGACCAGGG - Intronic
1055827321 9:80342780-80342802 CTCAATGACCAGTGGGTCAATGG + Intergenic
1056389948 9:86131729-86131751 CTCCATGACCATCAGGAACCTGG - Intergenic
1056943522 9:90975196-90975218 CTCCAGGACCAGGGAGACCTAGG + Intergenic
1057302435 9:93894629-93894651 CTCCATGTGCAGAGGGACCTGGG + Intergenic
1059506729 9:114806009-114806031 CTCCAGGAGCAGCAGGAGCATGG - Exonic
1061551433 9:131337027-131337049 CTCCATGGCCACCTGGGCCAGGG - Intergenic
1061899366 9:133665225-133665247 GTCCATAACCAACGTGACCAGGG - Intronic
1062558452 9:137128121-137128143 CTCCAGGACCTGTAGGACCACGG + Intergenic
1190402875 X:50056619-50056641 TTTCATGACCAGTGGAACCAGGG - Intronic
1198618393 X:138481854-138481876 CTCCATGCCCAGCAGGGCCTGGG - Intergenic
1200061318 X:153485036-153485058 CTGCATGGCCACAGGGACCAGGG + Intronic