ID: 1004116514

View in Genome Browser
Species Human (GRCh38)
Location 6:12773420-12773442
Sequence GTGAATCAGGTGAGGCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004116514_1004116517 22 Left 1004116514 6:12773420-12773442 CCATCTAGCCTCACCTGATTCAC 0: 1
1: 0
2: 0
3: 11
4: 202
Right 1004116517 6:12773465-12773487 ACAATGTATCGCTTCCCTGAAGG 0: 1
1: 0
2: 1
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004116514 Original CRISPR GTGAATCAGGTGAGGCTAGA TGG (reversed) Intronic
901399748 1:9007580-9007602 GCTCATCAGGTGAGGCTGGAGGG - Intronic
902682268 1:18051733-18051755 GGGAATCAGGTGAGGCTTCCTGG - Intergenic
905121917 1:35688901-35688923 GTGGCCCAGGTGAGGCTGGATGG + Intergenic
906527428 1:46503057-46503079 GTGAAGGAGGTAAGGTTAGAGGG - Intergenic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
907531525 1:55103214-55103236 GTGAACCAGGTGAAGCAAGGTGG - Intronic
908768668 1:67575951-67575973 GGAAATCAGGAGAGGCTTGATGG - Intergenic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
912480805 1:109980990-109981012 GAGAAGCAAGTGTGGCTAGAGGG - Intergenic
913327316 1:117638234-117638256 GTGCCTCACCTGAGGCTAGAAGG - Intergenic
913480785 1:119287163-119287185 GTGCTTCAGCTGAGGTTAGATGG - Intergenic
916589505 1:166176701-166176723 GTGAATGTGCAGAGGCTAGAGGG - Intergenic
917374364 1:174333163-174333185 GAGAATGAGGAGAGGGTAGATGG + Intronic
918019175 1:180668216-180668238 GTGAATCACTTGAGCCCAGAAGG - Intronic
918483350 1:185002806-185002828 ATGAATGAAGTGAAGCTAGAAGG + Intergenic
918934118 1:190898207-190898229 GTGACTCAGGTTAGGCTACATGG + Intergenic
919080737 1:192862866-192862888 GAGAATCACTTGAGGCCAGAAGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919944240 1:202308113-202308135 GTGAAGCGGGTGGGGCTGGATGG - Intronic
920046719 1:203137552-203137574 GTGATTCAGGTAAGGGAAGACGG + Intronic
920265261 1:204716748-204716770 GTGAATCAGGTTAGGGTGGGAGG + Intergenic
921961042 1:221034645-221034667 GTGAATAAGGAGAGTCTAGAGGG + Intergenic
924542343 1:244993277-244993299 GTGAATCACTGGAGGCCAGAAGG - Intronic
1064059147 10:12122786-12122808 CTGAGTCAGGTGAAGCTACATGG - Exonic
1064412647 10:15120725-15120747 GTGAATCATATCAGGCTGGATGG + Intronic
1065413490 10:25457830-25457852 GAAAATCAGATGAGACTAGAGGG + Intronic
1067512166 10:46905119-46905141 ATCAATCAGGTGAGGCCACAAGG - Intergenic
1067650078 10:48146703-48146725 ATCAATCAGGTGAGGCCACAAGG + Intergenic
1071153021 10:82657919-82657941 GTGAACCATGTGAGCTTAGAGGG - Intronic
1071202409 10:83234934-83234956 GTTAATCAGGTGACTCTAGGTGG + Intergenic
1073258571 10:102171606-102171628 GTTAATTAGGGGAAGCTAGAGGG + Intergenic
1074400438 10:113137267-113137289 TTAAATCAGAAGAGGCTAGAGGG + Intronic
1075576425 10:123580877-123580899 GTGGCCCAGGTGAGGCTGGAGGG - Intergenic
1077476047 11:2791038-2791060 GTCATTCAGGAGAGGCTTGAGGG - Intronic
1079105982 11:17572740-17572762 GTGTATGAGGTGAGGCAGGAGGG - Intronic
1080294055 11:30704910-30704932 GAGAATCACTTGAGCCTAGAAGG + Intergenic
1081983851 11:47287497-47287519 GTGAATCACTTGAGCCTGGATGG - Intronic
1082665104 11:55966370-55966392 CTGAATCAGCTGAGGCAAGGTGG + Intergenic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1085674464 11:78502764-78502786 GTGAATCAGCTGAGGCTGTCAGG + Intronic
1087100255 11:94356960-94356982 TTGATTGAGGGGAGGCTAGATGG + Intergenic
1087335765 11:96842302-96842324 GGGATTCAAGTCAGGCTAGATGG + Intergenic
1092595836 12:10003946-10003968 GTGGATTAGATGAGGTTAGATGG - Intronic
1092667253 12:10816318-10816340 TTCAATCAGCTGTGGCTAGATGG - Intergenic
1093038682 12:14355666-14355688 GTGAGTCAAGTGAGGTTAGCTGG + Intergenic
1095318922 12:40801676-40801698 GAGAACAAGATGAGGCTAGAGGG + Intronic
1095419036 12:42006188-42006210 GTGGATCACTTGAGGCTAGGAGG + Intergenic
1097287667 12:57890030-57890052 GTGAGGCAGGGGAGGCCAGAGGG + Intergenic
1101119248 12:101562115-101562137 GTTTTTCAGGTGAGGCTGGAGGG - Intergenic
1101516093 12:105436775-105436797 GTGATGCAGGAGAGCCTAGAGGG - Intergenic
1102607874 12:114083736-114083758 GTGACTTATGTGAAGCTAGATGG - Intergenic
1103650350 12:122427084-122427106 GAGAATCAGTTGAACCTAGAAGG + Intergenic
1103929908 12:124444625-124444647 GTGAATCTGGAGAGGGCAGAAGG + Intronic
1104074907 12:125380487-125380509 GTGATTCATCTGAGGCTGGAAGG - Intronic
1105270008 13:18864133-18864155 GAGAATCACTTGAGCCTAGAAGG + Intergenic
1105496625 13:20936182-20936204 GAGAATCACTTGAGGCTAGGAGG + Intergenic
1106128766 13:26922307-26922329 GTGGCTCAGGTGAGGCGAGGGGG - Intergenic
1109961058 13:69631787-69631809 GTGAATCAGGTTAAGTTATATGG + Intergenic
1110102896 13:71632006-71632028 GAGAATCAGTTGAGCCTAGGAGG + Intronic
1112226730 13:97546774-97546796 GAGGATCACGTGAGGCCAGAAGG - Intergenic
1113693726 13:112329733-112329755 GTGAATCAGGTGTGGGGAGAAGG + Intergenic
1113879264 13:113614563-113614585 GTGGATCAGGGGAAGGTAGAGGG + Intronic
1114326903 14:21598699-21598721 GAGAATCACTTGAGCCTAGAAGG - Intergenic
1115556876 14:34551009-34551031 GGGAATCAGGAGAGCCCAGAAGG + Intergenic
1116041074 14:39686980-39687002 GTGAATCACTTGGGGCTAAAGGG - Intergenic
1117533167 14:56678289-56678311 GTGGATCAGGTGAGAGTTGATGG - Intronic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1119880888 14:78098625-78098647 TGGAATGAGGTGAGGCCAGAAGG + Intergenic
1120759170 14:88270724-88270746 GTGATTCAGGTGAGAGAAGATGG - Intronic
1120944282 14:89979397-89979419 GTGAATCAGTTGAAGCTGGGAGG - Intronic
1125491136 15:40149450-40149472 GTAAATCAGGTGGGGCAAGTGGG - Intergenic
1127566773 15:60196962-60196984 GTGGATCACTTGAGGCTGGAGGG + Intergenic
1129662967 15:77563427-77563449 GTGAATCAGTTGACACAAGAAGG - Intergenic
1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG + Intergenic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133333982 16:4994855-4994877 GTGATTCAGGAGAGGGCAGAAGG - Intronic
1134190653 16:12118687-12118709 GTAACTCAGGTGAGGGTCGAGGG - Intronic
1134261824 16:12657063-12657085 GTGAAGCAGGTGAGGCTTTCTGG - Intergenic
1134267055 16:12701569-12701591 GTGAACCAGAAGAGGCTGGAGGG + Intronic
1134569857 16:15281842-15281864 GAGAATCATGTGAGCCTGGAAGG - Intergenic
1134934917 16:18237757-18237779 GAGAATCATGTGAGCCTGGAAGG - Intergenic
1137721600 16:50630640-50630662 GGGGAGGAGGTGAGGCTAGATGG + Intronic
1138536148 16:57661303-57661325 GTGAATCAGGTGAGTGGAGAAGG - Intronic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1142547815 17:717196-717218 GTGGATGGGGTGAGGCAAGAGGG - Intronic
1146566439 17:33917052-33917074 GGGAATCAGGTGAGGGGACATGG - Intronic
1147539798 17:41347555-41347577 GTCAAACATGTGAGGCTATATGG - Intronic
1147748925 17:42715359-42715381 GAGGATCAGTTGAGCCTAGAAGG - Intronic
1147864249 17:43542586-43542608 GTGAATGATGTGAGGCTAGGAGG - Intronic
1150506104 17:65700586-65700608 CTGAAGCAGGAGAGGCTACATGG + Intronic
1150976203 17:70089984-70090006 GTGAGACAGTTGAGGCTGGATGG - Intronic
1154418030 18:14195846-14195868 GAGAATCACTTGAGCCTAGAAGG - Intergenic
1155204627 18:23547514-23547536 GTGAATCACCTGAGGTTAGTAGG + Intronic
1155822862 18:30400099-30400121 GAGAATCACTTGAGGCCAGAAGG - Intergenic
1159964778 18:74584572-74584594 GTGGATCAGATCAGACTAGAAGG - Exonic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1163719892 19:18894036-18894058 GAGATTCTGGAGAGGCTAGAGGG + Intronic
926001867 2:9339811-9339833 GAGAGGCAGGTGAGGCTGGAAGG - Intronic
927980676 2:27373105-27373127 GTGAGTGAGGTGAGGCCAGCTGG + Intronic
931719799 2:65058828-65058850 GAGAATCAGGAAAGGCTAAAGGG - Intronic
931723498 2:65085396-65085418 CTGAATAAGGTGAGACTAAAGGG + Exonic
939225522 2:139359115-139359137 TTGAAACAGGTGAAGCTACATGG - Intergenic
942104483 2:172619259-172619281 GTGAATAAGGCAAGGCTTGAGGG - Intergenic
943122205 2:183750375-183750397 GTAAATCAAGAGAGGCTAGCAGG - Intergenic
943630314 2:190243741-190243763 GTGAATCACTTGAGCCTAGGAGG + Intronic
943795671 2:191989858-191989880 TTGAAGCATCTGAGGCTAGAAGG - Intronic
945040657 2:205741326-205741348 ATGATTGAGGTGAGGTTAGAAGG + Intronic
945156303 2:206842831-206842853 GTCAATCTGGTGAGTCTAAATGG + Intergenic
945186954 2:207148909-207148931 GGGAATCAGGTGAGGGTGGAGGG - Intronic
946596883 2:221315554-221315576 GTAAGCCAGGTGAGGCTTGAGGG - Intergenic
946724867 2:222652305-222652327 CTGAATCAGTGGAGGTTAGAGGG + Intronic
947997774 2:234543424-234543446 GTGAATAAGGTTGGGCTACAGGG + Intergenic
1168885301 20:1247656-1247678 TTAAATCATGTGAGGCTAAAGGG - Intronic
1171046604 20:21813988-21814010 GGGAATGAGATGAGGCTGGAGGG - Intergenic
1171221225 20:23399649-23399671 GTGAATCATGAGAGGCTGGTGGG + Intronic
1172436242 20:34930822-34930844 GAGAAACTGGTGAGGCTGGAGGG - Intronic
1173414603 20:42844679-42844701 GTGAGTCAGGAGAGGGGAGAGGG - Intronic
1175196490 20:57247178-57247200 ATGAATCAGTTGGGTCTAGAGGG - Intronic
1175436867 20:58958916-58958938 GTGAATGAGGTCAGGACAGAGGG + Intergenic
1176855266 21:13963432-13963454 GAGAATCACTTGAGCCTAGAAGG + Intergenic
1177461212 21:21413889-21413911 GTGTAGCAGGTGATGCTATAAGG + Intronic
1177666664 21:24168323-24168345 GTGAACAAGATGAGGCTAGTTGG + Intergenic
1178476659 21:32943373-32943395 GAGAATCACTTGAGCCTAGAAGG - Intergenic
1178525364 21:33324442-33324464 GGGAACCAGATGAGGCTGGAAGG - Intergenic
1178975210 21:37215481-37215503 GTGAATCACTTGAGGCCAGGAGG - Intergenic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1179895953 21:44363873-44363895 GTGGATCAGTGGAGGCTACAGGG - Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181827473 22:25529712-25529734 GTGACTAAGGAGACGCTAGAAGG - Intergenic
1182564407 22:31186643-31186665 GTGAATCTGCTGAGGCAGGAAGG - Intronic
1182579905 22:31300788-31300810 GTGAGTGAGGATAGGCTAGAAGG + Intergenic
1183196871 22:36359629-36359651 GTTAATCAGGGGGTGCTAGAAGG - Intronic
1183759831 22:39806012-39806034 GTGAATGAGGAAAGGCTAGAGGG - Intronic
949188233 3:1219379-1219401 GTGAAGGAGGAGAGGATAGAGGG + Intronic
952767722 3:36969573-36969595 GAGAATCAGTTGAGCCCAGAAGG + Intergenic
953018294 3:39098476-39098498 GTGTTGCAGGTGAGGCTACATGG - Exonic
956228646 3:66987959-66987981 GAGGATCAGTTGAGCCTAGAAGG + Intergenic
957285480 3:78212191-78212213 GTGAATCACTTGAAGCTAGGAGG + Intergenic
960169344 3:114440248-114440270 GTGAAGTAGATGAGGATAGATGG + Intronic
960771297 3:121195430-121195452 GTGAAGCAGGGGAGGGGAGAAGG - Intronic
962176680 3:133162733-133162755 ATGAATCAGTTGAGGCCAGCAGG - Intronic
964727209 3:159825862-159825884 GTGACTCAGGTGAAGGCAGAGGG + Intronic
965954187 3:174348519-174348541 GAGAATCACTTGAGGCTAGGAGG + Intergenic
967461523 3:189752261-189752283 GAGGATCAGGTGAGCCTAGGAGG - Intronic
968555980 4:1246726-1246748 GGGAACCAGGTGTGGCTTGACGG + Intronic
969963721 4:10973223-10973245 GTGAAGCAGGTGAGGCTCTCGGG - Intergenic
971854276 4:32023894-32023916 GTGATCCAGGTGAGATTAGAAGG - Intergenic
972228336 4:37041134-37041156 CTGAATTATGTGAGGCTGGATGG - Intergenic
975489238 4:74970366-74970388 GTGGACCATGTGAGGCTGGACGG + Intronic
977723633 4:100268879-100268901 GTGAATTATCTGAGGCAAGATGG - Intergenic
980445815 4:132906379-132906401 GTGAATTAGATGAGGCCATAAGG + Intergenic
982283700 4:153712798-153712820 CAGAATCAAGTGAGGCAAGAAGG - Intronic
984327263 4:178270110-178270132 GTAAATCAGATGAGGTTAGCAGG + Intergenic
984667245 4:182442040-182442062 GTGAATCAGGCAAGGCTAAATGG + Intronic
986331365 5:6718326-6718348 GTCAGTGAGGTCAGGCTAGAGGG - Intronic
986586910 5:9328261-9328283 GTGGATCAGGTGAGAGTAGAGGG - Intronic
989559120 5:42830699-42830721 GTAAATGAGCTGAAGCTAGAAGG - Intronic
990413804 5:55566792-55566814 GTGAATCACTTGAGGTTAGGAGG + Intergenic
991513938 5:67413153-67413175 GTGGATCACTTGAGGCCAGAAGG - Intergenic
993243386 5:85420194-85420216 GTCATGCTGGTGAGGCTAGATGG + Intergenic
995878337 5:116816293-116816315 GTCAATCAGCTGAGGCTGTATGG + Intergenic
996071174 5:119133620-119133642 GTGGAACGGGTGAGGCCAGAAGG - Exonic
996919542 5:128751725-128751747 GTGAATGAGCTAAGACTAGAGGG - Intronic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
1004116514 6:12773420-12773442 GTGAATCAGGTGAGGCTAGATGG - Intronic
1006352219 6:33529636-33529658 GAGAATCAGTTGAGCCTAGGAGG + Intergenic
1007254557 6:40519775-40519797 GGGAAGCAGGTGAGTCTATAGGG + Intronic
1007777003 6:44229463-44229485 GCCACTCAGGTGAGGCTGGAGGG + Exonic
1010016561 6:71110977-71110999 ATCAGTCAGGTGAGACTAGAGGG - Intergenic
1011706208 6:90003808-90003830 GTGAATGGGGTGAGGCCAAAGGG + Intronic
1011792696 6:90915497-90915519 GTGACCCAGCTGTGGCTAGAAGG + Intergenic
1013189074 6:107786600-107786622 CTGAACCAGGTGGGGATAGATGG - Intronic
1013596636 6:111666454-111666476 GTGGCTCCCGTGAGGCTAGAAGG - Intronic
1014051842 6:116963967-116963989 GAGAATCAGCTGAGCCCAGAGGG - Intergenic
1014232791 6:118922805-118922827 GTGGATCACCTGAGGTTAGAGGG + Intronic
1015485957 6:133769860-133769882 GTGAACAAAGTGAGGCAAGAAGG - Intergenic
1020234383 7:6344510-6344532 GTGGATCACTTGAGGCCAGAAGG - Intronic
1020855523 7:13416731-13416753 GTGTATCACGTGATGCTGGATGG + Intergenic
1023162819 7:37313753-37313775 ATGAATCAGGTGGTGGTAGAAGG - Intronic
1026552041 7:71376994-71377016 GAGAATCACTTGAGGCCAGAAGG + Intronic
1026582905 7:71632877-71632899 GTGAATCACTTGAGGCCAGGAGG + Intronic
1027125371 7:75553228-75553250 GAGGATCACTTGAGGCTAGACGG - Intronic
1027482611 7:78717530-78717552 GTGAATGAACTTAGGCTAGAGGG + Intronic
1027894555 7:84024314-84024336 GTGAATCACTTGAGGCCAGGAGG + Intronic
1030211877 7:107004908-107004930 GTGAAGCAGGTGAGACAAAAAGG + Intergenic
1030553124 7:110989455-110989477 GAGGATCAGGTGAGCCTAGGAGG + Intronic
1031683464 7:124703515-124703537 GAGAATCACTTGAGCCTAGAAGG - Intergenic
1033310661 7:140259704-140259726 GAGAATCAGGGAAGGCAAGATGG + Intergenic
1034420883 7:150990038-150990060 GGGAATTGGCTGAGGCTAGATGG - Intergenic
1036251547 8:7166845-7166867 GTGGATCATTTGAGGCCAGAAGG - Intergenic
1036365945 8:8120615-8120637 GTGGATCATTTGAGGCCAGAAGG + Intergenic
1037935576 8:22913168-22913190 GTGCATCAGGTGAGGGTTTAGGG - Intronic
1040531244 8:48268115-48268137 GGGAATGAGGAGAGGCCAGAAGG - Intergenic
1041926159 8:63238757-63238779 GAGAATCTCTTGAGGCTAGAAGG - Intergenic
1042170493 8:65986241-65986263 GAGAATCACTTGAGCCTAGAAGG - Intergenic
1047524088 8:125617716-125617738 TGGAATCAGGTGAGTCTGGAAGG + Intergenic
1048382691 8:133881507-133881529 TTGAATCAGATTAGCCTAGAAGG + Intergenic
1050746537 9:8882793-8882815 GAGAATCAGGTGAAGCCAGGAGG + Intronic
1051709389 9:19914734-19914756 ATGACTCAGATGAGGCAAGAAGG + Intergenic
1053197709 9:36132899-36132921 GTGACTCAGGCGCGGCCAGATGG + Intergenic
1054729500 9:68686407-68686429 GTGAATCACTTGAGCCCAGAAGG + Intergenic
1059880756 9:118686264-118686286 GAGAAACTGGTGAGGCTAGTTGG + Intergenic
1060039118 9:120284491-120284513 GTGACTCAGGTGAGGTTGGCAGG + Intergenic
1060873201 9:127059293-127059315 GTGAGTCAGATGAGGCGATAAGG + Intronic
1060902999 9:127277790-127277812 GGGAATCAGGTAAGGCTGCATGG - Intronic
1061070930 9:128310181-128310203 GTGGATCATGTGAGCCTAGGAGG - Intronic
1061875415 9:133541109-133541131 CTGAATCAGGTGCCCCTAGAGGG - Intronic
1061956682 9:133966609-133966631 GTGAATCACTTGAGCCTAGGAGG + Intronic
1187416775 X:19100097-19100119 GTGACTCAACTGAGGCTTGAAGG - Intronic
1189363620 X:40371541-40371563 GTGCCTCAGGTGAGCCTGGAGGG + Intergenic
1190543497 X:51501407-51501429 GTGAAGAAGGTGGGGCTAGCTGG + Intergenic
1190867404 X:54396565-54396587 GAGAATCAGTTGAGCCTAGGAGG - Intergenic
1192980702 X:76337439-76337461 GTGGATCACTTGAGGCCAGAAGG + Intergenic
1197537351 X:127707037-127707059 TTGAATCAGGTTTGGCTGGATGG + Intergenic