ID: 1004118134

View in Genome Browser
Species Human (GRCh38)
Location 6:12791195-12791217
Sequence CTGCAGAAGGAGAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 1, 1: 0, 2: 9, 3: 87, 4: 772}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004118134 Original CRISPR CTGCAGAAGGAGAAGGAAGC AGG Intronic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900281521 1:1872650-1872672 CTGAAGGATGAGAAGGAACCAGG - Intronic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901640469 1:10690574-10690596 CCCCAGAAGGAGAAAGAAACCGG + Intronic
902407316 1:16191829-16191851 CCGCAGAAGGAGGAGGAAGCTGG - Intergenic
902552834 1:17229466-17229488 CGGCAGAAGGACCAGCAAGCTGG - Intronic
902720247 1:18299467-18299489 ATACAGAGGGAGAAGGGAGCTGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903227885 1:21904156-21904178 GTGCTGAAGGGGAAGGAAGGGGG + Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
904147637 1:28406712-28406734 CCACAGGAGGAGTAGGAAGCTGG + Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904503160 1:30929388-30929410 CTGCAGACGCTGGAGGAAGCAGG + Intergenic
904610121 1:31721196-31721218 CTGAGGAAGGAGGAGGGAGCTGG + Intergenic
905108671 1:35578666-35578688 CTGGAGAAGGAGGAGGGAGCTGG + Intronic
905641857 1:39595482-39595504 GTTCAGGAGGAGAAGGGAGCTGG - Intergenic
905788858 1:40779475-40779497 CTGCACAGGGAAAAGGAAGAAGG + Intergenic
905797457 1:40823671-40823693 GTGCTGGAGGGGAAGGAAGCTGG + Intronic
905868418 1:41388951-41388973 GTGCAGAAGTAGATGCAAGCTGG - Intergenic
905942436 1:41874837-41874859 CTGGAGAAGGGAAAGGTAGCTGG - Intronic
906056669 1:42923500-42923522 GTGGAGAATGAGGAGGAAGCAGG + Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906837530 1:49100136-49100158 CTGAAGGAGGAGAAAGAAGTAGG + Intronic
907290048 1:53407798-53407820 CAGCAGAAGGTGAAGGGAGCAGG - Intergenic
907702972 1:56807138-56807160 CTGCAGCAGGAGAGGGCAGCAGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908548293 1:65183809-65183831 CTGCTGAAGGAGTAGGATGTTGG - Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
908775761 1:67638419-67638441 CTGTAGAAGAAGCAGCAAGCAGG + Intergenic
909098894 1:71325151-71325173 CTTGAGTAGGAGAAGGAAGCTGG - Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910162056 1:84283729-84283751 CAGCACAAGGAGACAGAAGCTGG - Intergenic
910523032 1:88145127-88145149 GTGCAGGAGGAGTAGGAAGAGGG - Intergenic
911292971 1:96080476-96080498 AGGCAGCAGGAGAAAGAAGCAGG + Intergenic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
912163790 1:107018505-107018527 CTTCAGACGGACAGGGAAGCCGG + Intergenic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
912681332 1:111730927-111730949 CTACACAGGGAGAAAGAAGCAGG + Intronic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
912724063 1:112043383-112043405 CTGCAGGAGGTGGAGGAAGAGGG + Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913611536 1:120514104-120514126 CTGCAGCAGGACATGGAGGCTGG - Intergenic
914402959 1:147341010-147341032 CTGCAGAAGAAGCTAGAAGCAGG - Intergenic
914579656 1:149008135-149008157 CTGCAGCAGGACATGGAGGCTGG + Intronic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
914946370 1:152070393-152070415 CTACTGAAGGAGGAGGAGGCAGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915024316 1:152812851-152812873 GCCCAGAAGGAGAAGGAAGACGG - Exonic
915029126 1:152861062-152861084 GTTCAGGAGGAGAAGGAAGGAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915164473 1:153941021-153941043 CTGCAGCAGCTGCAGGAAGCTGG + Exonic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915623174 1:157098582-157098604 ATGCAGGAGGAGAAGAAAACTGG + Intronic
916579385 1:166094081-166094103 GTGCAGCAGGGGAAGGAAGCAGG + Intronic
916758499 1:167796011-167796033 TTGCAGGAGGAAATGGAAGCTGG - Intergenic
917735613 1:177917272-177917294 CACCAGAAGGTGGAGGAAGCAGG + Intergenic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918617848 1:186568077-186568099 CTGCAGCATTAGTAGGAAGCAGG - Intergenic
918927635 1:190809036-190809058 GGGCTGAAGGAGGAGGAAGCTGG + Intergenic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920981781 1:210843396-210843418 CTTCAGAAGGTGGAAGAAGCAGG + Intronic
921190997 1:212708678-212708700 CTGATGAAGGAGAAGAAATCAGG + Intergenic
921333130 1:214060151-214060173 CTGCAGAATAAGCAAGAAGCTGG + Intergenic
921336561 1:214092883-214092905 GAGCTGAAGGAGGAGGAAGCTGG + Intergenic
921407756 1:214799603-214799625 CTGCAGCAGTAGAAGGGAGTAGG + Intergenic
921800851 1:219400140-219400162 GGGCTGAAGGGGAAGGAAGCTGG - Intergenic
921945405 1:220882763-220882785 CAGCAGGAGGAGGAGGAAGGAGG - Intronic
922068286 1:222165905-222165927 CTGAAGAAGGAGAAAGCAGTAGG + Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922450410 1:225732831-225732853 CTGCAGAAGGAGTGGGCATCGGG + Intergenic
922756743 1:228101193-228101215 CTGCTGTAAGAGGAGGAAGCGGG - Exonic
922993537 1:229937829-229937851 CCGGGGATGGAGAAGGAAGCAGG + Intergenic
923394227 1:233544666-233544688 CGGCACAGGGAGAAGGAACCAGG - Intergenic
923525619 1:234770273-234770295 CTGCAGAGGGAGCTGGGAGCTGG + Intergenic
924442989 1:244102368-244102390 GTGCAGAAGGAGAATGCTGCTGG - Intergenic
1063120748 10:3104224-3104246 CTCCAGAAGGAGTGGCAAGCAGG + Intronic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1064234603 10:13562606-13562628 CTGCTGAGGGAGAAGGGTGCTGG + Intergenic
1065087187 10:22190413-22190435 CTACAGAGGGGGAAGGAGGCAGG - Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065623428 10:27606895-27606917 CTGCAGAAGGTGCAAGATGCTGG + Intergenic
1065686826 10:28293958-28293980 CTGCAGAAAGAAAATGAACCAGG + Intronic
1065739580 10:28784768-28784790 ATGCAGACTGAGAAGGAGGCAGG - Intergenic
1065866467 10:29919286-29919308 GAGGAGAAGGAGAAGAAAGCAGG - Intergenic
1066162206 10:32746192-32746214 GGGCTGAAGGAGTAGGAAGCTGG + Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1068601777 10:58964393-58964415 CTGCAGAAGGAGAACCAAACAGG - Intergenic
1069335002 10:67338241-67338263 TGGCAGAAGGAAAGGGAAGCTGG + Intronic
1069520161 10:69112675-69112697 GTGCAGAACGAGAAGGAAACAGG - Intergenic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1071510913 10:86262128-86262150 TTCTAGAAGGAGGAGGAAGCAGG + Intronic
1071770878 10:88727901-88727923 CTGCAGCAGCAGAAGACAGCTGG + Intronic
1073073023 10:100806626-100806648 TTGCAGAAGTAGAAAGGAGCCGG + Intronic
1073125117 10:101144588-101144610 GTGCAGAAGGAGAGGGGATCTGG - Intergenic
1073439464 10:103544082-103544104 CTGCAGAGGGGGACGGAGGCTGG + Intronic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075403430 10:122177635-122177657 GAGCAGCAGGAGAATGAAGCTGG + Intronic
1075465393 10:122646980-122647002 ATGCAGAAGCAGCAGGAAGCTGG + Intergenic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077679865 11:4228860-4228882 CTACAGAAGAAGAATGATGCTGG + Intergenic
1077681620 11:4247053-4247075 CTACAGAAGGAGAAGGATGCTGG - Intergenic
1078731919 11:13982824-13982846 CTGCAGAGAGAGAAAAAAGCAGG - Intronic
1079157822 11:17964939-17964961 CTGTACAAGGAGCAGGAAACAGG + Intronic
1079321590 11:19455995-19456017 CTGCAGAGGGGGAGGGAAGGAGG + Intronic
1080205436 11:29723770-29723792 CTTCAGAATGCTAAGGAAGCTGG + Intergenic
1080380877 11:31771248-31771270 CTTCAGAATCAGAAGAAAGCAGG + Intronic
1080417564 11:32083158-32083180 CGGCAAAAGGATAAGGAAGTAGG - Intronic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081794067 11:45807797-45807819 CTGGAGAGGGAAATGGAAGCAGG - Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083301787 11:61743509-61743531 CTGCAGAGGGAGAGGAGAGCAGG - Intronic
1083429768 11:62608212-62608234 CTGCAGCCGGGGAATGAAGCTGG - Exonic
1083616348 11:64028420-64028442 CTGCAGAGGGAGGAGGGAGAGGG + Intronic
1083630734 11:64093937-64093959 CTGCAGAAGCAGAGGATAGCTGG + Intronic
1083913858 11:65727338-65727360 CTGCAGCAGCAGAAGACAGCTGG + Intergenic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1085016392 11:73176937-73176959 CTACAGGAGGAGCAGGAAGAGGG + Intergenic
1085860809 11:80233046-80233068 GGGCTGAAGGGGAAGGAAGCTGG + Intergenic
1086048286 11:82559090-82559112 CTGAAGATGGAAAAGTAAGCAGG + Intergenic
1086243843 11:84727535-84727557 CTGGACAAGAAGAAGAAAGCTGG - Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087091173 11:94274624-94274646 CTCCAGCAGCAGAAGGAAACAGG - Intergenic
1087743428 11:101915207-101915229 GAGCAGGAGGAGGAGGAAGCCGG + Exonic
1088057014 11:105595976-105595998 TGGCAGAAGGAGAGGGAAGGTGG - Intergenic
1088821749 11:113462681-113462703 CTCCAGAGGGAGAGGGAAGGTGG - Intronic
1089182205 11:116590795-116590817 AGGCAGAAGGAGAAGGCAGGAGG - Intergenic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1089645296 11:119874878-119874900 CAGCAGAAGGGGCCGGAAGCTGG - Intergenic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1090030559 11:123202634-123202656 CTCTAGAAGGAGAATGGAGCTGG - Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090879495 11:130821120-130821142 CTGCAGAAACAGGAGGAAACAGG + Intergenic
1090897894 11:130995437-130995459 CTACAGAAAGAGCAGGAAGCAGG + Intergenic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1090947359 11:131443086-131443108 CTGAAGACGGAGATGGAAACAGG - Intronic
1091046754 11:132332231-132332253 GGACAGAAGGAGAAGGAAACAGG - Intronic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1092263202 12:6963222-6963244 CGGCAGGCGGAGAAGGAAGGAGG + Intergenic
1092757655 12:11778572-11778594 CTCCACAAGGAAAAGGCAGCAGG - Intronic
1092838653 12:12516944-12516966 TTACTGAAGGAGAAGGAAGTGGG - Intronic
1093255542 12:16862684-16862706 TTGCAAAAGGAGAAAGAAGGAGG - Intergenic
1093481914 12:19612689-19612711 GGGCTGAAGGGGAAGGAAGCTGG - Intronic
1093508404 12:19896785-19896807 AGGAAGAAGGAGAAGGAAGGAGG - Intergenic
1093590753 12:20899388-20899410 TGGCAGAAGGAAAAGGAAGTGGG + Intronic
1093604608 12:21074525-21074547 TGGCAGAAGGAAAAGGAAGTGGG + Intronic
1094522629 12:31208946-31208968 CTGTAGAGGATGAAGGAAGCAGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096391452 12:51232314-51232336 AAGCAGAAGGGGAAGGAAGGAGG - Intergenic
1096649250 12:53053824-53053846 CTGGAGCAGGAGGGGGAAGCAGG + Intronic
1096650971 12:53061823-53061845 CTGCTGAAGGACAAGGACCCTGG + Exonic
1097983636 12:65759648-65759670 CCCCAGAATGAGCAGGAAGCAGG - Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1099528462 12:83744085-83744107 ATGCAGAAGAGGAAGAAAGCAGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1101402476 12:104400573-104400595 ATTCAGAAGGAGAAGGCAACAGG + Intergenic
1101606307 12:106249207-106249229 CTTCAGAATGGGAAGGAAACGGG + Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102302944 12:111783949-111783971 CTGCAAGAGGAGAAGAAACCAGG + Intronic
1102402390 12:112640855-112640877 ATGCTGAAGGAGAAGGGAGCTGG - Intronic
1102558900 12:113748290-113748312 CTGAAGAGGGAGAAGAAACCTGG - Intergenic
1103281480 12:119761349-119761371 CTCCAGAATGAGAAGGGAGGAGG + Intronic
1103432762 12:120903189-120903211 TTCCAGAAGGAAAAGGAAACAGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103687005 12:122740078-122740100 TGGCAGAAGGAGACAGAAGCAGG + Intergenic
1103690212 12:122766415-122766437 GTGCAGAATGAGAAGTAAGTGGG - Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1105340963 13:19525247-19525269 CTGCACAAAAAGAATGAAGCTGG + Intronic
1105502394 13:20983809-20983831 GTGTAGAAGGAAAAGGAAGGAGG + Intronic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1107421785 13:40254240-40254262 TGGCAGAAGGAGGAGGAAGGAGG - Intergenic
1107745731 13:43506193-43506215 CTGCATAAGAAGAACAAAGCTGG - Intronic
1108427503 13:50318820-50318842 AAGCAGGAGGAAAAGGAAGCAGG - Intronic
1111530203 13:89526632-89526654 CTGCAGACATAGAAGCAAGCTGG - Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1111997399 13:95178453-95178475 GCTAAGAAGGAGAAGGAAGCTGG + Intronic
1112044483 13:95582579-95582601 CTGGGGAAGGAGTGGGAAGCAGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113681739 13:112249253-112249275 CTGCTGGTGGAGAAGGATGCTGG + Intergenic
1114261429 14:21039336-21039358 CGATAGAATGAGAAGGAAGCAGG + Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114746849 14:25157533-25157555 CTGCTAAAGGGGAAGGAAGGAGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115761717 14:36582848-36582870 CAGGAGGAGGAGGAGGAAGCTGG - Intergenic
1115863141 14:37711994-37712016 CTGGACAAAAAGAAGGAAGCAGG + Intronic
1115900772 14:38145066-38145088 CTGGAGAAGGAGAAGTTACCTGG + Intergenic
1116336563 14:43665300-43665322 TAGCTGAAGGGGAAGGAAGCTGG + Intergenic
1116809211 14:49523406-49523428 ATGCAGAAGAGGGAGGAAGCTGG - Intergenic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118326408 14:64784470-64784492 CTGCAGAAGGAGAAGGCCATGGG + Intronic
1118478384 14:66140504-66140526 CTATAGAAGGAGAAAAAAGCAGG + Intergenic
1118928566 14:70217378-70217400 CTGCAGAAGGGACATGAAGCAGG + Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1120560150 14:85981672-85981694 ATGCTTAAGCAGAAGGAAGCAGG - Intergenic
1121099976 14:91243770-91243792 CAACTGAAGGAAAAGGAAGCTGG - Intronic
1121242973 14:92443081-92443103 TTGCAGAGGGAGATGGAAGTGGG + Intronic
1121392787 14:93590329-93590351 CTGCAGTGGGAGGAAGAAGCTGG + Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122337579 14:101004144-101004166 AGGCAGAAGGAGGAGGCAGCTGG - Intergenic
1122534349 14:102451875-102451897 CTGGAGAAGGCTTAGGAAGCTGG - Intronic
1122873612 14:104652552-104652574 CTCCATATGGAGAAGGATGCGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124173097 15:27395055-27395077 CTCCAGAAGGAGAGGGCAGAGGG - Intronic
1124216269 15:27809144-27809166 CTCCAGAAAGTGAAGGAATCTGG - Intronic
1124431272 15:29610831-29610853 CTGCAGAGGGATAAAGAAGGAGG - Intergenic
1124559896 15:30761784-30761806 CTGCAAACAGATAAGGAAGCTGG - Intronic
1124671347 15:31643934-31643956 CTGCAAACAGATAAGGAAGCTGG + Intronic
1125186876 15:36941033-36941055 CTGCAGAAGAAGAATGGAGGGGG - Intronic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1125721377 15:41846753-41846775 CTGCAGGAGGGGCAGGCAGCTGG - Exonic
1125731965 15:41897557-41897579 CTGGAGCAGGAGGCGGAAGCAGG + Exonic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127849919 15:62903338-62903360 CTGCGGAAGGAGGAAGCAGCAGG - Intergenic
1127855539 15:62950657-62950679 ATGCAGAAGGACATGGCAGCAGG - Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128359253 15:66949331-66949353 CTTGAGAAAGAGAAGGAAGGGGG - Intergenic
1128749809 15:70140794-70140816 CTGCAGCTGGAGAAGAAGGCAGG + Intergenic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1128968659 15:72086691-72086713 CTGCAATAGGGGAAGGGAGCAGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129232255 15:74203318-74203340 CTCCAGGAGGAGCAGGAGGCAGG - Intronic
1129582806 15:76830880-76830902 GGGCTGAAGGGGAAGGAAGCTGG + Intronic
1129728433 15:77915892-77915914 CTCCCGAAGGAGAAGGCAGATGG - Intergenic
1130780531 15:87033729-87033751 GTGCAGCAGGACAAGGAAACGGG + Intergenic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131075257 15:89491337-89491359 GTGCCCAAGGAGAAGGAAGTGGG - Intronic
1131437540 15:92435404-92435426 GTGCTGCAGGAGCAGGAAGCAGG + Intronic
1131994572 15:98121794-98121816 CTGTAGGAGGAAAAGGAAGCTGG - Intergenic
1132466142 16:78185-78207 GCGCAGAAGGGGACGGAAGCCGG - Intronic
1132689545 16:1176450-1176472 CTGCAGAAAGAGACGGCAGCTGG - Intronic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1133111058 16:3548627-3548649 CTGCAGAAGGGGAACAGAGCAGG + Intronic
1133255636 16:4514187-4514209 GGGCTGAAGGAGAAGGAACCTGG - Intronic
1133662463 16:7932137-7932159 GTGCAGAGGGAGAAGCAAACAGG + Intergenic
1134222005 16:12362394-12362416 CTGCAGCAGGTGGAGGAGGCTGG - Intronic
1134759477 16:16701336-16701358 CTGCAGAAGGAGATGGAGTGAGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134986593 16:18657858-18657880 CTGCAGAAGGAGATGGAGTGAGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135405810 16:22196951-22196973 CTCCTGAAAGAGAAGGAAGGGGG - Intergenic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136163169 16:28434766-28434788 CTGCAGAAAAAGAAGAAACCAGG + Intergenic
1136199796 16:28680221-28680243 CTGCAGAAAAAGAAGAAACCAGG - Intergenic
1136216144 16:28794394-28794416 CTGCAGAAAAAGAAGAAACCAGG - Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138293546 16:55868123-55868145 CTACAGCAGGAGATGGATGCGGG - Intronic
1138699659 16:58849012-58849034 CTACGGGAGGACAAGGAAGCTGG + Intergenic
1138976590 16:62214817-62214839 GGGCTGAAGGGGAAGGAAGCTGG - Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139839709 16:69868424-69868446 CTGCAGAGGGACAGGGAACCCGG + Intronic
1140046278 16:71442158-71442180 ATCCAGAAGGAGGAGAAAGCCGG + Intergenic
1140854710 16:78967887-78967909 CTGCAGGAGGAGGAGGGAACAGG + Intronic
1140973876 16:80040863-80040885 CTGGAGAAAAAGAAGAAAGCGGG - Intergenic
1141148019 16:81545554-81545576 CTGTAGATGGAGGAGGATGCTGG - Intronic
1141149827 16:81556266-81556288 CTGCAGAAGGAGGTGGCGGCGGG + Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141457916 16:84156494-84156516 CAACAAAAGGAGAAGCAAGCAGG - Intronic
1141855428 16:86677900-86677922 CTGCTGAAGGAGGAGGAAACTGG - Intergenic
1141860175 16:86710979-86711001 CTTCAGATGGAGCAGGAAGGGGG + Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142523331 17:520022-520044 CCGCAGGAGGAGACGGGAGCGGG + Intronic
1143123355 17:4624074-4624096 CTGCTGTAGGAGGAGGAAGGGGG + Intergenic
1143377366 17:6474605-6474627 CTGCGGAGGGAGGAGGACGCAGG + Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143426684 17:6845126-6845148 CTGCTGTAGGAGGAGGAAGGGGG - Intergenic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1144762391 17:17714723-17714745 CTGCAGAAGGGCACAGAAGCAGG + Intronic
1145979772 17:29004761-29004783 CTGCAGCGGGAGAAGGACGTGGG + Intronic
1145989857 17:29072796-29072818 CTACAGAATGAGAAGGTAGAAGG + Intergenic
1146123728 17:30216271-30216293 GGGGAGAAGGAGAAGGGAGCGGG + Intronic
1146430034 17:32784342-32784364 TTGGAGAAGGAGAGGGAATCTGG - Intronic
1146510289 17:33441603-33441625 TGGGAGAAGGAGAAGGAAGGAGG - Intronic
1147714207 17:42493380-42493402 CTGCACAAAGAGAAGACAGCTGG + Intronic
1147863566 17:43538374-43538396 CTGCAGAAGGCAAAGGACACTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148955539 17:51350770-51350792 AGGCAGAAGAAGAAGGAAACTGG + Intergenic
1150255657 17:63742035-63742057 CCGCAGCAGGAGGGGGAAGCAGG + Intronic
1150752395 17:67877268-67877290 CCACAGAAACAGAAGGAAGCAGG - Intronic
1150943345 17:69717482-69717504 CTGCTGAAGGGGCTGGAAGCAGG - Intergenic
1151226894 17:72654638-72654660 TTGCAAAAGGTCAAGGAAGCTGG - Intronic
1151364753 17:73609988-73610010 CTGCTGAACAAGATGGAAGCAGG + Intronic
1151733589 17:75925194-75925216 CTGCAGGTGCTGAAGGAAGCGGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152126432 17:78450100-78450122 CTGCAGATGGAGCTGGAAGAGGG - Intronic
1152183418 17:78839932-78839954 CTTTAGAAGGAGGAGGGAGCGGG - Intronic
1152358346 17:79817415-79817437 CTGCAGGTGGAGCAGGAAGGTGG + Intergenic
1152463936 17:80455267-80455289 CTGCAGCAGGGGAAAGAAGGAGG + Intergenic
1152933471 17:83122417-83122439 ATGCAGAAGGAAGAGGAAGGAGG + Intergenic
1153230122 18:2927093-2927115 TCCCAGGAGGAGAAGGAAGCTGG - Intronic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1153652399 18:7252709-7252731 ATTCAGAGGGGGAAGGAAGCAGG - Intergenic
1153821429 18:8835337-8835359 GTGCAGGAGGAGAAGCAAGTGGG + Intergenic
1153884130 18:9448002-9448024 ATGCAAAAAGAGAAGAAAGCTGG + Intergenic
1153986750 18:10357553-10357575 ATGGTGAAGGGGAAGGAAGCAGG - Intergenic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155657444 18:28208785-28208807 CTGCAGACAGACAAGCAAGCTGG + Intergenic
1156197221 18:34788552-34788574 GTGCAGAAGGTGCAGGAACCGGG - Intronic
1156965379 18:43085046-43085068 GAGTAGAATGAGAAGGAAGCGGG + Intronic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1157277824 18:46324296-46324318 ATGCACAAGGAGAGGCAAGCAGG - Intergenic
1157680129 18:49598546-49598568 GAGGAGAAGGAGAAAGAAGCAGG - Exonic
1157809689 18:50685710-50685732 CTTGAGAAGGCGAAGGATGCAGG - Intronic
1157907509 18:51582757-51582779 CTGCTGTTGGAGAAGGAGGCTGG + Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158673947 18:59501562-59501584 TTCCAGGAGGAGGAGGAAGCAGG - Intronic
1158962518 18:62598125-62598147 CCTCAAAAGGAAAAGGAAGCGGG - Intergenic
1159503128 18:69299116-69299138 CAGCAGTGGGAGAAGAAAGCAGG - Intergenic
1159586657 18:70288983-70289005 CTGGAGGAGGAGGAGGAAGGAGG + Exonic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1160013827 18:75125915-75125937 CTGCAGAGGGAGGAGGAACAGGG - Intergenic
1160141269 18:76325336-76325358 GTGCAGGAGGAGAAGTGAGCCGG - Intergenic
1160417522 18:78721439-78721461 CTTCAGAAGGGGAAGGGAGAGGG + Intergenic
1160561322 18:79758345-79758367 CTGAAGGAGAAGAAAGAAGCTGG - Intergenic
1160777260 19:862010-862032 CTGCAGAGGGAGCGCGAAGCGGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1163420384 19:17210763-17210785 CTGCTGGAGGAGGAGGCAGCCGG + Exonic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164400046 19:27896116-27896138 TTACAGAAGGTGAAGGAGGCAGG - Intergenic
1164686869 19:30172448-30172470 CTGGAGCAGGAGAAGGGAGCTGG + Intergenic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1165481223 19:36065676-36065698 CGGCAGAGGGAGAAGAAAGCAGG + Intronic
1165852695 19:38859415-38859437 CTGCTGAAGGATATGGAGGCTGG - Intergenic
1166497126 19:43311697-43311719 CAACAGTAGGAGAAGGAAGGTGG + Intergenic
1167096048 19:47375622-47375644 CTGCAGGAGGAGCAGGACGGCGG + Exonic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1168082943 19:54023775-54023797 CTGCAGCTTGAGAAGGAAGTGGG - Intergenic
1168246707 19:55116243-55116265 CCCCAGAAGGAGAAGGAAAAGGG + Intronic
925010689 2:483628-483650 TGGCAGAAGGCGAGGGAAGCAGG + Intergenic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
927217677 2:20677622-20677644 CTGCTGAATTAGAAGGAAACAGG + Intergenic
928680704 2:33699709-33699731 GGGCTGAAGGAGGAGGAAGCTGG + Intergenic
928697056 2:33859982-33860004 CCGCAGGAGGGGAAGGAAGGAGG - Intergenic
928998097 2:37317680-37317702 TTTCAGAAGGCTAAGGAAGCAGG + Intronic
929385644 2:41403173-41403195 CTGCAGACAGACAAGCAAGCTGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930035837 2:47084510-47084532 CTCCAGAGGGAGAAAAAAGCAGG + Intronic
930242161 2:48947114-48947136 CTACAGTAGGAGAAGAAAGAAGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930929473 2:56862726-56862748 GGGCTGAAAGAGAAGGAAGCTGG - Intergenic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931673189 2:64668115-64668137 CTGCAGTAGGCAGAGGAAGCAGG - Intronic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932733946 2:74241135-74241157 AGGCAGAAAGAGAAGGAAGAAGG + Intronic
933633535 2:84682533-84682555 GTGCACACTGAGAAGGAAGCTGG - Intronic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934103728 2:88677502-88677524 ATGCAGAAGGAGAAGCATGTTGG + Intergenic
935199319 2:100842550-100842572 CTGCAGAAAGAGGAGGCAGCTGG - Intronic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
936069450 2:109355858-109355880 TTTCAGAAGGACAAGGAAGGAGG - Intronic
936659221 2:114523608-114523630 CTGTAGAGGGAAAAGGAAGTGGG + Intronic
936847386 2:116853786-116853808 GGGCAGAAGGAGGAGAAAGCTGG + Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
937308725 2:120888152-120888174 CTCCAGAGGGAGAAGGGAGTCGG + Intronic
937453585 2:122022704-122022726 GTGCAGAAGTAGGAGGTAGCTGG + Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
938052509 2:128187551-128187573 TTTCAGAAGGAGAAAGAAACGGG + Exonic
938576255 2:132607099-132607121 GTGTAGAATGAAAAGGAAGCAGG + Intronic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
938655700 2:133430862-133430884 GTGGAGAGGGAGAAGGAAGGAGG + Intronic
939131708 2:138243080-138243102 CTGCAGACCGATAAGCAAGCTGG - Intergenic
939199800 2:139019003-139019025 AGGTTGAAGGAGAAGGAAGCTGG - Intergenic
939510769 2:143101606-143101628 TGGCGGGAGGAGAAGGAAGCAGG + Intronic
940051709 2:149471798-149471820 CTGCAGATGGAGTAAGAAGCTGG - Exonic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941821654 2:169849872-169849894 ATGCAGGAGAGGAAGGAAGCAGG + Intronic
942220812 2:173767359-173767381 CTTCAGAAAGAGCAAGAAGCAGG + Intergenic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
943725903 2:191251088-191251110 CTGGGGAAGGAGAATGACGCAGG - Intronic
944427937 2:199603389-199603411 CTGCAGGGGCAGAAGGGAGCTGG + Intergenic
944446742 2:199799417-199799439 CTACAGAAGCAGAAGGCAGCCGG - Intronic
944819206 2:203412338-203412360 CTACAGAAGCAGAAAAAAGCAGG - Intronic
945808437 2:214518610-214518632 CTGTTGAAGGACAAGGAAGGGGG - Intronic
946103851 2:217352101-217352123 GGGCTGAAGGAGAAAGAAGCTGG - Intronic
946284814 2:218694927-218694949 CTGGAGGAGGAGAACGAAGCAGG - Intronic
946579904 2:221117152-221117174 CTGAAGTACGAGAAGGAACCAGG - Intergenic
946598715 2:221335476-221335498 CAGCATAAGGAGACGGTAGCCGG - Intergenic
947738656 2:232474463-232474485 CTCCACAGGGAGAAGGAAGCTGG + Intergenic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948247518 2:236499054-236499076 CCCCTGAAGGAGAAGCAAGCCGG + Intronic
948376571 2:237524898-237524920 CTCCAGGAGGAGGGGGAAGCAGG + Intronic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948601193 2:239108281-239108303 CCCTAGAAGGAGACGGAAGCTGG + Intronic
948756536 2:240162818-240162840 CAGCTGGAGGAGAAGGCAGCTGG - Intergenic
949066165 2:241991547-241991569 CTGGCGAAGGTGAGGGAAGCAGG - Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168889624 20:1286408-1286430 CTGGAGAGGGAGAAGGGAGCTGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172283367 20:33723624-33723646 CAGCTGAAGGAGAAGGAAAGAGG + Intergenic
1172494234 20:35367271-35367293 CTGTAGAAGCACACGGAAGCTGG - Intronic
1172602097 20:36190870-36190892 CTGCAGAATGAGCAGGAAAATGG + Intronic
1172607918 20:36227546-36227568 CCTCAGAGGGACAAGGAAGCAGG - Intronic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1173324244 20:42018246-42018268 CTGCAGAACAAGAAGCATGCAGG - Intergenic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174960501 20:55151686-55151708 CAGCAGTAGGAGGAGGAAGAAGG - Intergenic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175287458 20:57846496-57846518 GGGCACAGGGAGAAGGAAGCAGG - Intergenic
1175315001 20:58040973-58040995 CGGCAGAAGGAGGATGGAGCAGG - Intergenic
1175588621 20:60168781-60168803 GGGCAGAGGAAGAAGGAAGCTGG + Intergenic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176369175 21:6052265-6052287 CTGCAGCAGCAGAGGGCAGCTGG + Intergenic
1177047459 21:16187861-16187883 AGGCAGAAAGAGAAGGAAGGAGG - Intergenic
1178490854 21:33050611-33050633 CTCCATAAGGAGAAGGAAGGAGG - Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1179442698 21:41406456-41406478 CTGTTGAAGGAGCAGAAAGCTGG + Intronic
1179606197 21:42517048-42517070 CTGGACAAGGAGATGGAAGTAGG + Intronic
1179754344 21:43486276-43486298 CTGCAGCAGCAGAGGGCAGCTGG - Intergenic
1179777128 21:43672217-43672239 CGGAAGTGGGAGAAGGAAGCAGG + Intronic
1180223648 21:46376082-46376104 CTGCAGACGGAGAGGGTAGAGGG - Intronic
1182087158 22:27569145-27569167 CTGCAGAATAAGAAAGGAGCCGG - Intergenic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1183971219 22:41478974-41478996 CTGCAGAAGGTCAAGGAGCCCGG - Intronic
1184138379 22:42562685-42562707 CTCCAGGAGGAGAAAGGAGCTGG + Intronic
1184345516 22:43910316-43910338 CTGCAGAAGCAGAGGGCAGGGGG - Intergenic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1184682596 22:46080147-46080169 CGGGAGAGGGAGGAGGAAGCCGG - Intronic
1184855416 22:47143921-47143943 CTGGAGCAGAAGAAGGCAGCGGG - Intronic
1185203109 22:49520675-49520697 CTCCAGGGGGTGAAGGAAGCTGG - Intronic
949494522 3:4619524-4619546 CGGCAGAAGGGGATGGAAGTTGG - Intronic
949520046 3:4843153-4843175 CTGCTAAAGGAGAAGGAATTGGG - Intronic
949919432 3:8989488-8989510 GTTCAAAAGGAGAAGGAAGAAGG - Intronic
950122750 3:10492678-10492700 CCCCAGAGGGAGAAGGAAGCGGG - Intronic
950173496 3:10855416-10855438 CTGCAGGAGTAGAAGACAGCAGG - Intronic
950586341 3:13895201-13895223 CCGAAGAAGGGGAGGGAAGCAGG + Intergenic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
951688649 3:25372523-25372545 CTGCAGAAAGAGAAATGAGCTGG + Intronic
952280082 3:31914433-31914455 CTCCAGAAGGATATGGCAGCAGG + Intronic
952622857 3:35367401-35367423 AGGCCGAAGGGGAAGGAAGCCGG + Intergenic
952905955 3:38139148-38139170 CTGCAGAGGGAGAACCATGCGGG + Intronic
953215183 3:40911441-40911463 CAGCAGAAAGAGAATAAAGCTGG - Intergenic
953485323 3:43289153-43289175 CTGCAGAAGCACAAGGATGGCGG + Intronic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
953778324 3:45842285-45842307 CTGCAGTTGCAGAAGGTAGCGGG + Intronic
953956449 3:47235538-47235560 TTGTAGAAGGAGATGGAATCAGG + Exonic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
954402523 3:50326480-50326502 GTGTAGAGGGAGAAGGAAACAGG + Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954759977 3:52866991-52867013 CTGCATAAAGACAGGGAAGCCGG + Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
956339986 3:68211715-68211737 TGGCAGAAGGTGAAGGGAGCTGG + Intronic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957878732 3:86183285-86183307 GGGCTGAAGGAGAAGGAAACTGG + Intergenic
958193761 3:90216656-90216678 GTGTAGAAAGAGAAGCAAGCAGG - Intergenic
958735093 3:97999889-97999911 GTGGAGAAGGTGAAGGAAGGAGG + Intronic
959385041 3:105693519-105693541 CTGGAGGAGGAGGAGAAAGCCGG + Exonic
959440080 3:106363091-106363113 GAGCTGAAGGAGGAGGAAGCTGG - Intergenic
959679730 3:109081281-109081303 GTGCAGAAGTAGAAGCAAGCTGG + Intronic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
960962618 3:123082952-123082974 CTGCAGAGGGAGAAGAGAGTGGG + Intronic
961060232 3:123822489-123822511 CTGCAGATGAAGAAGGATGGAGG - Intronic
961356533 3:126343276-126343298 ATGCTGGAGGAGAAGGAAGTAGG - Exonic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961935205 3:130575683-130575705 CTCCAGAAGGAGAAGGTACTAGG + Intronic
961997309 3:131259570-131259592 GGACAGAAGGAGAAGGATGCAGG + Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962371424 3:134823860-134823882 CAGCAGAATGAGAAGAAAGCAGG + Intronic
962390009 3:134963181-134963203 GTACAGAAGAAGAAGGAAGAAGG - Intronic
962407089 3:135109727-135109749 GTGCAGTGGGAGAAGGAAGGAGG + Intronic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
963544182 3:146633872-146633894 CTGAAGGAGGAGAAAAAAGCTGG - Intergenic
963646823 3:147925335-147925357 CTGGAGAAGGAGCTGGGAGCTGG + Intergenic
965213162 3:165822713-165822735 CTGCAAGAGTAGAAAGAAGCTGG + Intronic
965629065 3:170711975-170711997 ATGCAAAAGGCAAAGGAAGCAGG + Intronic
965678265 3:171222713-171222735 CTTCAGAAAGAGATGGAGGCTGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
966274108 3:178143604-178143626 CTGCAGAAAGAGAAAGAAGTGGG - Intergenic
966706938 3:182926378-182926400 CTGCAGAGGGAAAATGAAGCAGG - Intergenic
966950191 3:184810247-184810269 CTACAGAAGGATAAGCAAGCTGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968666829 4:1827031-1827053 CTGCAGAAGGCGCAGGGAGAGGG + Intronic
969230377 4:5826474-5826496 CTGCAGGAGGACGAGGAAGGAGG + Intronic
969386883 4:6857365-6857387 CTGCAGATGGAGCATGAGGCTGG - Intronic
969696829 4:8739839-8739861 CTGCAGAAGGAAGAGGAGCCTGG + Intergenic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
971969186 4:33599864-33599886 CTACAGACAGAGAAGCAAGCTGG + Intergenic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
976372814 4:84309668-84309690 TTGGAGATGGACAAGGAAGCAGG - Intergenic
976391049 4:84503911-84503933 CTGCACAAGGAGGCGGCAGCTGG - Intergenic
976575599 4:86666969-86666991 CTGCAGACGGACAAGCAAGCTGG - Intronic
978128982 4:105170942-105170964 GTGTAGAAGGAGGAGGAAGTTGG - Intronic
978265259 4:106816086-106816108 CTGCAGAGGGGCGAGGAAGCTGG - Intergenic
978665710 4:111178574-111178596 CAAGAGAAGGAGAAAGAAGCAGG - Intergenic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
979800657 4:124904623-124904645 ATGTAGAAAGAAAAGGAAGCAGG - Intergenic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
980454557 4:133022493-133022515 AAGCCGAAGAAGAAGGAAGCTGG + Intergenic
980532308 4:134071236-134071258 GGGCAGAATGAGGAGGAAGCTGG - Intergenic
980574422 4:134666592-134666614 CTGCAGGAGGCCAAGGCAGCAGG + Intergenic
981171864 4:141635034-141635056 CTGCAGCCGGTGAAGGAAGCAGG - Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
981850038 4:149219024-149219046 CTGCAGTATGAGGAGGGAGCAGG - Intergenic
981955570 4:150469052-150469074 AATCAGAAGGAGAAGGAAGTGGG - Intronic
983231982 4:165138098-165138120 TTGTAGAAGGAGAGGGAAACAGG + Intronic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
983640461 4:169940315-169940337 TGGCAGAAGGGGAAGGAAACGGG - Intergenic
983847927 4:172542373-172542395 CTGCAGACAGACAAGCAAGCTGG - Intronic
983975533 4:173929202-173929224 CTGCATAAGGAGAAAGAAGGTGG - Intergenic
984235971 4:177159519-177159541 GGGCTGAAGGAGGAGGAAGCTGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984863607 4:184261463-184261485 CTGCAGAAGAGGAAAGGAGCTGG - Intergenic
985063673 4:186102072-186102094 CTCCTGAAGGAGAAGGGTGCTGG + Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985386560 4:189453721-189453743 CTGAAGAAGGAGAAGGGAATTGG + Intergenic
985679653 5:1249290-1249312 GTGCAGAAGGAGAAGTGAGGCGG + Intergenic
985901490 5:2798771-2798793 GTGCTGAAGGAGAAGGCTGCTGG - Intergenic
985958433 5:3281748-3281770 GGGAAGAAGGAAAAGGAAGCAGG + Intergenic
986264743 5:6182066-6182088 GTGCAGAAGGTGACAGAAGCTGG + Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986485372 5:8230780-8230802 GTGCAGAAAGAGAAGAAAGGAGG + Intergenic
987297781 5:16569198-16569220 CTACTGAAGGAGGATGAAGCTGG + Intronic
987638769 5:20583548-20583570 CTGCAGAAAGATAAGCAATCGGG - Intergenic
988194873 5:27992152-27992174 CTGGAGTAGGAGAAGGAATTAGG - Intergenic
988669205 5:33362796-33362818 CTGCAGTCTGAGAAGGAGGCAGG + Intergenic
988778540 5:34498696-34498718 CTGCAGAAGGAACAGAAAGGAGG + Intergenic
989564303 5:42886202-42886224 CTGCTGTAGGAAAAGGAAGAAGG - Intronic
990134750 5:52631593-52631615 GGGCTGAAGGAGGAGGAAGCTGG - Intergenic
991230512 5:64328018-64328040 TTCCAGAAGGAGGAGGAAGAGGG + Intronic
993476118 5:88366682-88366704 GTGCAGAAAAAGAAGGTAGCTGG + Intergenic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
993944000 5:94096814-94096836 GGGCTGAAGGAGGAGGAAGCTGG + Intronic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
995500143 5:112795458-112795480 CTCCAGGAAGAGAAGGAGGCTGG - Intronic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
997079422 5:130721176-130721198 CTGCAGCAGTAGATGGGAGCAGG + Intergenic
998011731 5:138700589-138700611 AGGCAGAGGGAGAAGGAAACAGG - Intronic
998189079 5:140007210-140007232 CTGCTCTAGGAGAAGGAAACTGG + Intronic
998196445 5:140076937-140076959 CTGCCCAAGAAGAAGAAAGCAGG - Intergenic
998332709 5:141343795-141343817 CTCAAGAAGGAGAACGCAGCTGG + Intronic
998498903 5:142614857-142614879 CTGCAGAATGGGCAGGAACCAGG - Intronic
998627615 5:143863479-143863501 CTGCTGGAGGACAAGGAAGATGG - Intergenic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999450830 5:151676789-151676811 TTGCAGAGGGAGTAGGAAGGAGG - Intronic
999505141 5:152186676-152186698 CTGCAGAGGAAGAAGGAAGTTGG - Intergenic
999701806 5:154235095-154235117 CTGTGGAAGGACAAGGAACCTGG + Intronic
999850241 5:155529700-155529722 CATCAGAAGGAGGAGGATGCTGG + Intergenic
999922422 5:156336082-156336104 AGGCAGAAGGGGAAAGAAGCAGG - Intronic
1000134882 5:158337485-158337507 GGGCTGAAGGAGGAGGAAGCTGG - Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001548261 5:172584038-172584060 CTGGAGGAGGAAAAGGAAGGAGG + Intergenic
1001642139 5:173252112-173252134 CTGCAGAAGGAGAAACAAGCAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1002460305 5:179369958-179369980 GTGGAGAAGGAGATGGGAGCTGG + Intergenic
1002506126 5:179680270-179680292 CTGCTGAAGGATTAGAAAGCCGG + Intronic
1002535834 5:179874871-179874893 CCCCAGCAGGAGAAGGAACCCGG + Intronic
1002709192 5:181184090-181184112 CTGCAGGAGGAGAGGGGACCTGG - Intergenic
1002854305 6:1023702-1023724 CTGCAGAAGGAAAAGGAGTCTGG - Intergenic
1002855558 6:1034882-1034904 CTGCAGAAGGAGCAACAAGCTGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003197310 6:3926248-3926270 CAGCAGGAGGAGGAGAAAGCAGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003318508 6:5032901-5032923 CAGCAGGAGGAGGAGAAAGCAGG - Intergenic
1003343142 6:5240922-5240944 ATGCAAAAGGAGGTGGAAGCAGG + Intronic
1003873303 6:10417842-10417864 CTGCCGCAGGAGGAGGAAGGAGG - Intronic
1003947423 6:11088167-11088189 GGGCAGAAGGAGACGGGAGCAGG - Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1005286277 6:24330481-24330503 CTTCAAAAGGAGAAGGAATTTGG + Intronic
1005900445 6:30213025-30213047 CTGCGGAACCAGAAGTAAGCGGG - Intronic
1006154556 6:32007246-32007268 CTGCAGAGGGTGAAAGGAGCGGG - Intergenic
1006160867 6:32039982-32040004 CTGCAGAGGGTGAAAGGAGCGGG - Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007501012 6:42296845-42296867 TTGCAGAATGGGAATGAAGCAGG + Intronic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008705561 6:54154382-54154404 CTGCTGGAGGGGAAGTAAGCTGG + Intronic
1008960448 6:57260844-57260866 CAGCAGAAGGAAAAGTCAGCAGG + Intergenic
1009401984 6:63267373-63267395 TTCCAGTTGGAGAAGGAAGCAGG - Intergenic
1009734852 6:67663188-67663210 CTGCAGTGGGAGAAAGATGCTGG + Intergenic
1010042076 6:71396775-71396797 GTGCAGAAGGGGTAGGAAGAGGG - Intergenic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1010766190 6:79778988-79779010 CTGCAGAAGGAGAGGCCAGGTGG + Intergenic
1011211551 6:84960866-84960888 CTGCCTAAGTAGAAGAAAGCTGG + Intergenic
1011242319 6:85286038-85286060 CGACAGAGGAAGAAGGAAGCGGG + Intergenic
1011885685 6:92092045-92092067 CTGAGGCAGGAGAATGAAGCCGG + Intergenic
1011908486 6:92404241-92404263 CTGCAGAAGAAGTTTGAAGCTGG - Intergenic
1012348476 6:98221649-98221671 CTCCAGAAGAAGAAGAAAGATGG + Intergenic
1012382118 6:98632492-98632514 GTGCATATGGAGAGGGAAGCTGG - Intergenic
1012602843 6:101119293-101119315 TGGCAGAAGGTGAAGGGAGCAGG - Intergenic
1012627466 6:101421371-101421393 CGGAAGAAAGAGGAGGAAGCAGG + Intronic
1012900177 6:104996147-104996169 TTGCAGAGGGTTAAGGAAGCAGG + Intronic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013349131 6:109290312-109290334 CTTGGGAAGGTGAAGGAAGCCGG + Intergenic
1013432237 6:110065359-110065381 GTGCAGATGGGGAAGGAAACAGG + Intergenic
1013620528 6:111883957-111883979 CAGCAGAAGGCAGAGGAAGCCGG + Intergenic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1013910574 6:115271658-115271680 CTGCAGAAGGGGAAGTAAACAGG - Intergenic
1014489649 6:122046065-122046087 TTGCAGAAGAAAAAGGAAGCTGG + Intergenic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015301984 6:131663441-131663463 CTTCAGAAGGCCAAGGAAGGAGG + Intronic
1015754462 6:136593517-136593539 CCCCAGAAGGAAAAGGAAACAGG + Intronic
1015837048 6:137431699-137431721 TTGCAAAAGGAGAAGGAATAGGG + Intergenic
1015868687 6:137753913-137753935 CAGCTGTAGGATAAGGAAGCTGG + Intergenic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1015991057 6:138943352-138943374 CTGCAGAATAAGAGAGAAGCTGG + Intronic
1016411578 6:143788750-143788772 CTGCAGGAGGACAAGGAAAAAGG - Intronic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016896521 6:149059388-149059410 CTGCAGAAGGACACGAAAGGTGG + Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1016971948 6:149772226-149772248 CTTCAGAGGCAGAAAGAAGCAGG + Intronic
1017359879 6:153555353-153555375 TTGGAGAAGGAAAAGGAAACTGG - Intergenic
1017382787 6:153849499-153849521 CTGCAAAAGGATATGGCAGCAGG + Intergenic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1017771002 6:157644457-157644479 CTCTAGAAGGAGACGGTAGCGGG - Intronic
1018198728 6:161376777-161376799 CTTCAGGAAGAGAAGGAAGCAGG - Intronic
1018282780 6:162206027-162206049 CGAGAGAAGGAGAAGGAAGAAGG + Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018983434 6:168617459-168617481 CTGAAGACGGGGCAGGAAGCTGG + Intronic
1019022221 6:168929012-168929034 GTTCAGAAGGAGAAGCAAGATGG + Intergenic
1019261467 7:84273-84295 CTGCAGAGCGAGAGGGAAACTGG + Intergenic
1019326618 7:441549-441571 CTGCCGAGGGGGAAGGAAGGAGG + Intergenic
1019701362 7:2476331-2476353 CTGGAGAAGGAGAACGGTGCAGG - Intronic
1020408908 7:7868414-7868436 GTGCAGAAGGGGAAGTAAGCAGG - Intronic
1020469530 7:8520391-8520413 CTGCAGGAGGAGAAGCCAGACGG + Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021425502 7:20495498-20495520 GGGCTGAAGGGGAAGGAAGCTGG + Intergenic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1022200695 7:28114249-28114271 TTGCAGAAGGTAAAGGTAGCAGG - Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1022488360 7:30797813-30797835 CTGCAGTAGTAGAAGAGAGCTGG + Intronic
1022551907 7:31248752-31248774 GTGAAGAAGGAGAAAGAAGCAGG - Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022811347 7:33872001-33872023 CTACAGAAGGAGAAGTAAAGAGG - Intergenic
1023027456 7:36063628-36063650 CTGTGGATGGAGCAGGAAGCAGG + Intergenic
1023119764 7:36897564-36897586 GAGGAGTAGGAGAAGGAAGCTGG + Intronic
1023135681 7:37049418-37049440 ATGCAAAAGGAGAAGAGAGCTGG - Intronic
1023169064 7:37373116-37373138 GTGCAGCAGGAGACGGAATCAGG + Intronic
1023693434 7:42818642-42818664 AGGAAGAAGGAGAAGGAAGGAGG + Intergenic
1024219367 7:47275964-47275986 CATCAGAAGGATAAGGAACCTGG + Exonic
1024863958 7:53881235-53881257 CTGCATAAGAAGCAGGCAGCAGG - Intergenic
1025142593 7:56478524-56478546 CTGCAGAAGGAGCAGGGCTCTGG + Intergenic
1025610805 7:63074050-63074072 CTGCAGAAGGAGCAGGGCTCTGG - Intergenic
1025708654 7:63889125-63889147 CTGCAGAAGGAGCAGGGCTCTGG + Intergenic
1026104170 7:67407903-67407925 ACACAGAAGGAGAAGGAAGTGGG - Intergenic
1026228756 7:68465398-68465420 CTTCAGAGTGAGAAGGAAGAGGG - Intergenic
1026394570 7:69938249-69938271 CTGCAGAAGGAGACAGCACCTGG - Intronic
1026584293 7:71643692-71643714 TTGCAGCAGCAGAAGGCAGCAGG + Intronic
1026775189 7:73226788-73226810 CTCCAGAAGGAGGAAGAGGCCGG + Intergenic
1026938987 7:74275761-74275783 CTGGAGATGGAGAGGGAAACAGG - Intergenic
1027016046 7:74780159-74780181 CTCCAGAAGGAGGAAGAGGCCGG + Intronic
1027071983 7:75165778-75165800 CTCCAGAAGGAGGAAGAGGCCGG - Intergenic
1027161175 7:75803511-75803533 ATGCAGAAGAAGAGGGTAGCAGG - Intergenic
1027164415 7:75824238-75824260 AGGCCTAAGGAGAAGGAAGCAGG + Intergenic
1027640243 7:80724102-80724124 CTCCAGAATGAGAAGGAACATGG + Intergenic
1027816840 7:82984784-82984806 CTTCAGAAGTAGCAAGAAGCAGG - Intronic
1028726799 7:94097086-94097108 CTCCAGACAGAAAAGGAAGCAGG + Intergenic
1030580113 7:111344361-111344383 CTGAAGGAAGAAAAGGAAGCAGG - Intronic
1031313088 7:120223726-120223748 CTTCAGAATGAGCAGAAAGCTGG - Intergenic
1031471112 7:122170301-122170323 CTGTAGGAGGACAAGGAAGGCGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031981637 7:128130777-128130799 CTGCTGCAGGACAAGGAGGCAGG + Intergenic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1033255613 7:139798985-139799007 CGGCAGGTGGAGAAGGAGGCTGG - Intronic
1033360444 7:140635545-140635567 CTTCAGAAGGAAATGAAAGCAGG - Intronic
1033467445 7:141608287-141608309 CTGCAGATGGTCAAGGAAGGTGG + Intronic
1034244608 7:149634940-149634962 CTGAAGAAGGAGGAGGAATTAGG + Intergenic
1034413345 7:150952666-150952688 CTGCTGAAGGAGACGGAAGAAGG - Exonic
1034709338 7:153177059-153177081 CTGCAGAGGGAGAAGGTTTCTGG - Intergenic
1034940495 7:155227334-155227356 CTGCAGGAGGAGGTGGCAGCTGG + Intergenic
1035223168 7:157418766-157418788 CCCCAGGAGGAGAAGGGAGCTGG + Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035739303 8:1914190-1914212 CTCCTGAAGTAGAAGGCAGCAGG + Intronic
1036007797 8:4686837-4686859 CTGCAGGGAGAGAAGGAAGGAGG + Intronic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1036672489 8:10801186-10801208 CTGCAGAAAGGGAAGGAAGGGGG + Intronic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1036796051 8:11757568-11757590 GTGGGGAAGGAGGAGGAAGCTGG + Intronic
1037878517 8:22561312-22561334 CTGCAGGAGCAGAAGGGACCAGG - Intronic
1038208171 8:25489186-25489208 CTGGAGAAGGAAAAGGAACTGGG - Intronic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038541827 8:28396186-28396208 CTATAGAAGGATAAGGAAGAAGG - Intronic
1038613302 8:29072317-29072339 CTGCAGCAGGACGGGGAAGCAGG + Intronic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039291301 8:36096809-36096831 CTGCAGACAGATAAGCAAGCTGG - Intergenic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1040641494 8:49339711-49339733 TTACAAAAGGAGAAGCAAGCTGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1044532086 8:93318631-93318653 ACACAGAAGGAAAAGGAAGCGGG + Intergenic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1044751095 8:95416036-95416058 CTGCTGAAAGAGAAGAAAGAAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1046850162 8:118963067-118963089 ATGCAGAGGGGGAAGGGAGCCGG + Intergenic
1046854800 8:119019029-119019051 CTGCAGAAGGGGAAGATAGTAGG - Intronic
1047289252 8:123514812-123514834 CTGCAGAAGCAGGAGGTATCAGG - Intronic
1047290488 8:123525287-123525309 CTGCAGAGGGACAAAGAAACTGG + Intronic
1047916576 8:129590472-129590494 CTGCAAATGGAAAAGGCAGCTGG - Intergenic
1048141414 8:131798266-131798288 AGGCAGAAGGAGATGGATGCTGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048608827 8:135999800-135999822 CAGCAGATAGAGAAGGAAGTAGG - Intergenic
1048650098 8:136466470-136466492 CTGCCTAAGGAGTAGGAAACAGG - Intergenic
1048892210 8:138958360-138958382 CTGCAGGAGGAGCTGGGAGCAGG - Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049180391 8:141219150-141219172 CTGGAGAAGGAGAAAGCAGTAGG + Intronic
1049657822 8:143806528-143806550 CTGCAGAAGGAGCAGGAATGCGG - Intronic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050096044 9:2067570-2067592 CTGCAGAAGCCCTAGGAAGCAGG + Intronic
1050565209 9:6875124-6875146 CTGGAGAAGAGGAAGGAAACGGG - Intronic
1051034655 9:12729135-12729157 TTGAAGAAAGAGAAGGCAGCTGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1055294021 9:74815597-74815619 CACCAGGAGGAGAAGGAAACTGG + Intronic
1055481213 9:76710734-76710756 CTGCAGAATGAGAAGATTGCTGG + Exonic
1056295242 9:85186516-85186538 CTGCAGACGGAGAGTGAAGCAGG - Intergenic
1056484315 9:87040146-87040168 CACCAGAAGGATGAGGAAGCTGG + Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1057242414 9:93423211-93423233 CAGCAGCAGGATAGGGAAGCTGG + Intergenic
1057412360 9:94828042-94828064 AGGCAGAAGGCGAGGGAAGCAGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058872320 9:109213280-109213302 ATACAGAAGGAGAAGGAGACAGG - Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059248766 9:112869492-112869514 TTGCAGGAGGACAAGGACGCTGG - Exonic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059315131 9:113417831-113417853 CTGCAGTAGAAACAGGAAGCAGG + Intronic
1059339241 9:113588115-113588137 CTGCAGGGGAGGAAGGAAGCAGG - Intronic
1059426258 9:114222674-114222696 GTCCAGAGGGAGAAGGTAGCTGG + Intronic
1059621511 9:116010991-116011013 CTGAAGAAGGTGAAGGGACCAGG + Intergenic
1059796234 9:117700154-117700176 CTGCAGAATGTGAAGAAAGTAGG - Intergenic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060103235 9:120857842-120857864 CTGGGGTGGGAGAAGGAAGCAGG - Exonic
1060198711 9:121639580-121639602 CTGCGGAGGGAGGTGGAAGCTGG + Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060545132 9:124454898-124454920 CTCCAGAAGGCCCAGGAAGCTGG - Exonic
1060667176 9:125438897-125438919 TTCCAGAAGGAGAAGAAATCCGG - Exonic
1061421510 9:130475212-130475234 ATGCAGAATGAGGAGGAGGCTGG + Intronic
1061458945 9:130720701-130720723 CTGAAGGAGGACAAGGGAGCAGG + Intronic
1061667801 9:132170457-132170479 CTGCAGGCCGAGAAGGAGGCAGG + Intronic
1062370150 9:136234670-136234692 CAGCAGGTGGAGACGGAAGCAGG + Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062549393 9:137078953-137078975 CTGCAGACGGAGAAGGGAATGGG - Intronic
1062643216 9:137532819-137532841 CTGGAGAAGGTGAAGCAAGCAGG + Intronic
1203775566 EBV:71309-71331 CGGCAGGAGCACAAGGAAGCAGG - Intergenic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186613282 X:11159586-11159608 CTGCAGGAGGAGAAGGTTGGGGG + Intronic
1186920837 X:14278196-14278218 CTGAACAAAGAGAACGAAGCTGG + Intergenic
1187034285 X:15521642-15521664 CTGCAGAACCAGAAGGTTGCAGG + Intronic
1187607913 X:20906214-20906236 GCGCTGAAGGAGGAGGAAGCTGG - Intergenic
1187766433 X:22647688-22647710 CTGCAGAGGGTGAGGGGAGCAGG + Intergenic
1188803303 X:34558046-34558068 CTGCAGAACCTCAAGGAAGCAGG + Intergenic
1188833658 X:34931479-34931501 GGGCTGAAGGAGAAGGAAGCTGG + Intergenic
1188941271 X:36241036-36241058 AGGCTGAAGGAGGAGGAAGCTGG + Intronic
1189386340 X:40539811-40539833 CTGTAGGAGGAGGAGGAAGTGGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189961973 X:46332742-46332764 CACCAGAAGGAGAGGGAACCTGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191732562 X:64353006-64353028 ATGCAGGGGGAGAAGGAAGGAGG - Intronic
1191812435 X:65203564-65203586 CTACAGTAGGATAGGGAAGCAGG - Intergenic
1191816646 X:65253227-65253249 GGGCTGAAGGAGAAGGAAGCAGG + Intergenic
1192340964 X:70263050-70263072 AAGCAGTAGGAGCAGGAAGCTGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1194383933 X:93229882-93229904 CTGGAGTAGAAGAAGGTAGCTGG - Intergenic
1194610290 X:96035161-96035183 CTGAAGAAAGAAAGGGAAGCAGG - Intergenic
1195997863 X:110749373-110749395 CTGCAGGAGGGGGAGGAAGAGGG - Intronic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1196230559 X:113216442-113216464 TGGCTGAAGGAGGAGGAAGCTGG - Intergenic
1196554312 X:117069715-117069737 GTGCTGAAGGGGGAGGAAGCTGG + Intergenic
1197333436 X:125181700-125181722 CCACAGAAGGAGAGGGAAGGAGG + Intergenic
1197690409 X:129494570-129494592 CTACAGAAGGAGAGGGATGCGGG + Intronic
1197883731 X:131195983-131196005 CTGTAGAAGGTGTAGGAAACTGG + Intergenic
1198024002 X:132687248-132687270 CAGCAGAAGGGGAAGGGAGGAGG + Intronic
1198052847 X:132965135-132965157 CTGGAGAATTTGAAGGAAGCAGG + Intergenic
1198209924 X:134507247-134507269 CTGGAGGAGGAGAACCAAGCAGG + Intronic
1198312979 X:135438258-135438280 CTGCAGCTGGAGAAGGACCCTGG + Intergenic
1198499411 X:137228087-137228109 CTTCAAAAGGAGGAGGAATCAGG - Intergenic
1198673050 X:139102313-139102335 CTGCAAAATGAGAATGATGCTGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199418281 X:147612397-147612419 TTCCAGACAGAGAAGGAAGCAGG + Intergenic
1199786662 X:151112256-151112278 CTGCAGTGGGAGAAGGATGCGGG + Intergenic
1199827905 X:151517328-151517350 CGGCTGAAAGAGAAGGAAGCTGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1200885507 Y:8264455-8264477 CTGAAAAAGGAGACCGAAGCAGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201275155 Y:12290095-12290117 CTGCAGAGGGAAGAGCAAGCAGG - Intergenic
1201639605 Y:16165094-16165116 CTGCAGCTAGAGAAGTAAGCTGG + Intergenic
1201663208 Y:16420230-16420252 CTGCAGCTAGAGAAGTAAGCTGG - Intergenic