ID: 1004122106

View in Genome Browser
Species Human (GRCh38)
Location 6:12833843-12833865
Sequence GAGTAGAAGGAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1743
Summary {0: 1, 1: 0, 2: 8, 3: 144, 4: 1590}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004122106_1004122112 0 Left 1004122106 6:12833843-12833865 CCAGCCTCCCTCTCCTTCTACTC 0: 1
1: 0
2: 8
3: 144
4: 1590
Right 1004122112 6:12833866-12833888 CTGCCCGTACTTACCATGCTTGG No data
1004122106_1004122113 1 Left 1004122106 6:12833843-12833865 CCAGCCTCCCTCTCCTTCTACTC 0: 1
1: 0
2: 8
3: 144
4: 1590
Right 1004122113 6:12833867-12833889 TGCCCGTACTTACCATGCTTGGG 0: 1
1: 0
2: 3
3: 5
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004122106 Original CRISPR GAGTAGAAGGAGAGGGAGGC TGG (reversed) Intronic
900122161 1:1053433-1053455 AAGCAGGAAGAGAGGGAGGCGGG - Intronic
900166089 1:1244899-1244921 GAGGAGGAGGAGGGGGAGGTGGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900484276 1:2914099-2914121 GGGTAGAAGGCGAGGGGGTCTGG + Intergenic
900508657 1:3044878-3044900 GAGTGGAAGGAGGGAGAGGATGG - Intergenic
900724166 1:4204189-4204211 GAGTAGCAGGAGATGGGGACAGG + Intergenic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
901078772 1:6571893-6571915 GGGAAGAAGGAAAGGCAGGCAGG - Intronic
901105386 1:6751863-6751885 GAGTAGGAGGAGGAGGAGGAGGG - Intergenic
901159370 1:7163322-7163344 GAGACCAAGGAGCGGGAGGCCGG + Intronic
901174296 1:7287466-7287488 GAGAAGAAGGAAAGGGAGAAAGG - Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901469189 1:9443871-9443893 GAGGAGAAGGAGGGAGAGGAAGG - Intergenic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901629774 1:10642481-10642503 GGGCAGGAGGAGAGAGAGGCGGG + Intronic
901633649 1:10659771-10659793 GTGTTGAAGGACAGGGAGGCAGG + Exonic
901650221 1:10738719-10738741 GAGGGGGAGGAGAGGGAGGCAGG + Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901821466 1:11832935-11832957 GTCTAGAAGGAGAGGCAGCCTGG + Intronic
902123073 1:14184311-14184333 GAAGAGAAGGCGAGGGAGGGAGG - Intergenic
902246435 1:15124111-15124133 GGTTAGAAGGGGAGGAAGGCTGG - Intergenic
902371274 1:16008553-16008575 GAGGCCAAGGAGGGGGAGGCGGG + Exonic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902833242 1:19031001-19031023 GAAGAGAAAGAGAGGGAGGGAGG + Intergenic
902943495 1:19816782-19816804 GAATAGAATGGGAGGCAGGCTGG - Intergenic
903066710 1:20703701-20703723 GAATAGATGGAGAGGAAGGTGGG + Intronic
903218802 1:21857490-21857512 GGGTAGAATGAGAGCTAGGCTGG - Intronic
903296512 1:22346736-22346758 GAGGAGGAGGAGAGGAAGGGAGG - Intergenic
903559227 1:24215511-24215533 AAGCAGAAGGAGAGGAGGGCAGG + Intergenic
903921800 1:26804847-26804869 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904350019 1:29899039-29899061 GAGTAGAGCGAGGGGGGGGCAGG + Intergenic
904412046 1:30330437-30330459 GAGAGGAAGGAGAGGAAGGAGGG - Intergenic
904469533 1:30727905-30727927 GAAGAGAGGGAGAGGGAGGGAGG - Intergenic
904497240 1:30893808-30893830 GGGTAGCAGGAGAGGGAGTGTGG - Intronic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904920131 1:34000958-34000980 GAGTAGAAAGAGGAGGAGGAAGG + Intronic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
905009060 1:34734596-34734618 GAGTGGCCTGAGAGGGAGGCTGG + Intronic
905204885 1:36337751-36337773 GAGAAGGATGAGAGGGAGGGAGG + Intergenic
905205135 1:36339141-36339163 GAGGAGAGGGAGGGGGAGGGTGG + Intergenic
905462016 1:38128117-38128139 GAGGACAAGGAGGGGGAGGAAGG + Intergenic
905875224 1:41427899-41427921 GAGGAGGAGGACGGGGAGGCGGG - Intergenic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906002456 1:42438558-42438580 GAGTAGGAGGAGAAAAAGGCTGG - Intronic
906072842 1:43029640-43029662 GAGGAGGAGGACAGGGAGGAGGG - Intergenic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906464399 1:46063320-46063342 GATTAGCAGATGAGGGAGGCTGG + Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906835382 1:49078193-49078215 GAGTAGGAGGAGAGAGAAGCAGG + Intronic
906852952 1:49271705-49271727 GAGAAGAAGGAGGGGTAGGGAGG - Intronic
907657524 1:56359480-56359502 GAGCAGGAGGAGAGAGAGACAGG - Intergenic
907745171 1:57206206-57206228 GAGGAGAAGAGGAGGGAGGCAGG + Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
907933310 1:59019790-59019812 GAGTGGCAGGAGAGTGAGGATGG + Intergenic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908628140 1:66070420-66070442 AAGTAGATGGAGTGGGAAGCTGG + Intronic
908936018 1:69376501-69376523 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
908990651 1:70084097-70084119 GAATAGAAGGAGAGGAAGGTGGG - Intronic
909116753 1:71546978-71547000 AAGTAAAAGTAGAGAGAGGCTGG + Intronic
909502647 1:76353186-76353208 GAATAGAAGGCCAGGGTGGCTGG - Intronic
909622472 1:77683404-77683426 AAGTGGCAGGAGCGGGAGGCGGG - Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
909907504 1:81216817-81216839 GGGTTGCAGGAGAGGGAGGTTGG + Intergenic
909938063 1:81577306-81577328 GAGTAGAAGGGGATGAAAGCAGG - Intronic
910163227 1:84296592-84296614 GAGGAGCAGGAGAGGGAGAGAGG + Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910447046 1:87309482-87309504 GAGTAAAGGGAGAGGAATGCCGG - Intergenic
910523294 1:88148504-88148526 GAAGAGAGGGAGAGGGAGGGAGG + Intergenic
910573339 1:88730387-88730409 GAGCAGAAAGAGAGAGAGCCTGG - Intronic
910845174 1:91598374-91598396 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
910849026 1:91632961-91632983 GAGTACAGGGAGAGAGAGGTGGG - Intergenic
911245430 1:95511384-95511406 GGGTAGAAGGAGAGGGAAATGGG - Intergenic
911316382 1:96361423-96361445 GAGTAGAAGAGGAGGGAGAAAGG - Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911949770 1:104157481-104157503 GAACAGAAGGAGAGGCATGCAGG - Intergenic
912451326 1:109769354-109769376 GAGAAGAGGGATTGGGAGGCAGG + Intronic
912493866 1:110078753-110078775 GGGCAGATGGAGAGGCAGGCAGG + Intergenic
912735648 1:112147194-112147216 AAGGAGAAAGAGAGGGAGGGAGG - Intergenic
912880426 1:113406904-113406926 GAGTTGAATGACTGGGAGGCAGG + Intronic
912991771 1:114494398-114494420 GAGGATAAGGAGTGGGAGGGAGG + Intronic
913056830 1:115169945-115169967 GGATAGAAAGAGAGGGAAGCAGG - Intergenic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913280481 1:117180787-117180809 GAGCAGAAGTGGAGAGAGGCGGG - Intronic
913380085 1:118201161-118201183 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
913458209 1:119055724-119055746 GAGGAGGAGAAGAGGGAGGGAGG + Intronic
913524186 1:119675516-119675538 TGGTCGAAGGGGAGGGAGGCCGG + Intronic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914058627 1:144187754-144187776 GAAAAGAAGGAGAGGGAAGAAGG - Intergenic
914120522 1:144778617-144778639 GAAAAGAAGGAGAGGGAAGAAGG + Intergenic
914196799 1:145451941-145451963 GAGAAACAGAAGAGGGAGGCGGG + Intergenic
914260699 1:145996809-145996831 GAGAGGAAGGAGAGGAAGGAGGG + Intergenic
914263615 1:146019622-146019644 GAGGAGGAGGAGGAGGAGGCCGG - Exonic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914814396 1:151052891-151052913 GAGGAGAAGGGCAGGGAGGTAGG + Exonic
914829830 1:151162874-151162896 GAGTAGAAATAGAGCGAGGAAGG - Intronic
914862282 1:151396818-151396840 GAGAAGAGAGAGAGGGAGGGAGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915154612 1:153864643-153864665 GAGATGAAAGAGAGGGAGGGAGG + Intronic
915161253 1:153922498-153922520 GTGAAGAAGGAGCGCGAGGCGGG + Intronic
915275197 1:154783692-154783714 GACTGGAAGGAGAGGGGAGCTGG + Intronic
915465911 1:156097816-156097838 GAGGAGAGTGAGAGGTAGGCTGG - Intronic
915530506 1:156500061-156500083 GAGAGGAGGGAGAGGGAGGGAGG + Intronic
915606430 1:156954763-156954785 GAGAAGAAAGAAAGGGAGGGAGG + Intronic
915901005 1:159846802-159846824 GAGGACAAGGAGAGAGAGGTAGG + Intronic
915954037 1:160208322-160208344 GCTTGGAAGGAGAGGGAGGCAGG + Intronic
916030107 1:160869179-160869201 GGGTAGAAGGAGAGTGAGAGAGG + Intergenic
916048235 1:161016799-161016821 GAGTAGAGGGAGAGGAAAGGAGG + Intronic
916441050 1:164825050-164825072 AGGTAGAAGGACAGGAAGGCTGG - Intronic
916522794 1:165580277-165580299 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916746239 1:167686988-167687010 GAGTAAAAGCAGAGGGAGTTAGG + Intronic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
916833793 1:168520773-168520795 GAAGAGAATGAGGGGGAGGCAGG - Intergenic
917036063 1:170748174-170748196 GAGTAGGAGGGAAGGGAGGGAGG - Intergenic
917070171 1:171141899-171141921 GAGAAGAAGGAGAGGTGGGAAGG - Intronic
917149883 1:171932023-171932045 GGGGAGAGGGAGAGGGAGGGAGG - Intronic
917597459 1:176543624-176543646 GAGATGAAGGAGAGGAAGGTGGG - Intronic
917660102 1:177170005-177170027 GAATTGAAAGAGAGGGAGGGAGG - Intergenic
917734802 1:177910577-177910599 GAGTACACCGAGAGGGAGGAAGG + Intergenic
918050237 1:180967273-180967295 GAGCTGGAGGAGAGAGAGGCTGG - Intergenic
918056397 1:181025323-181025345 GAGTAGAAGGAAAAGGATGGGGG + Intergenic
918073692 1:181153001-181153023 GAGTGGGTGGAGAGGAAGGCGGG - Intergenic
918092671 1:181310873-181310895 GAGTAAAAGGAGGGGGAAGTGGG - Intergenic
918146724 1:181763139-181763161 CAGTAGAAGACTAGGGAGGCTGG + Intronic
918373698 1:183887190-183887212 GAGAAGAAGGAGGGGAAGGAGGG - Intronic
918420491 1:184359858-184359880 GGGAAGGAGGAGTGGGAGGCGGG - Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918513448 1:185336573-185336595 GATTGGGAAGAGAGGGAGGCTGG + Intergenic
919055572 1:192565762-192565784 GAGGAGGTGGAGAGGGAGGAAGG + Intergenic
919209497 1:194461562-194461584 GAGGAGGAGGAGATTGAGGCGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920046504 1:203136238-203136260 GAGAAGAAGGAGAGGCAGATGGG + Intronic
920062086 1:203233934-203233956 GAGGAGATGGAGCAGGAGGCAGG - Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920311967 1:205053927-205053949 GAGGAGAGGCAGAGGAAGGCTGG + Intronic
920345193 1:205301767-205301789 GGGTGGGAGGAGAAGGAGGCAGG + Intergenic
920420146 1:205827687-205827709 GTGGAGGAGGAGGGGGAGGCTGG - Intergenic
921049338 1:211499973-211499995 GAGTGCAAGGAGAGTGAGACAGG - Intergenic
921402627 1:214743045-214743067 GAGGAGAAGGAGAGAGATGGGGG + Intergenic
921468864 1:215524696-215524718 TACTAGAAGGGGAGGGAGGAGGG - Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
921928310 1:220732029-220732051 AAGTAGAATGAAAGGGAGCCTGG + Intergenic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
922228824 1:223668137-223668159 GAGCAGGAGGAAAGGTAGGCAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
922967092 1:229699368-229699390 GAGGAGGTGGAAAGGGAGGCAGG + Intergenic
923009551 1:230077264-230077286 GAGGGGAAGGAGAGTGCGGCAGG - Intronic
923051745 1:230394980-230395002 GAGTGGGAGGAGAGGAAGGGAGG - Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923161267 1:231316900-231316922 GAGGGGATGGAAAGGGAGGCAGG - Intergenic
923441514 1:234024970-234024992 GACTACAAGAAGAGGGAGGGTGG - Intronic
923482334 1:234397209-234397231 GAGGAGGAGGAGGGGGAGGAGGG + Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923503462 1:234585539-234585561 GAGCAAAAGCAGAGGGTGGCAGG - Intergenic
923556850 1:235007795-235007817 GAGTTGGAGGAGTGTGAGGCCGG + Intergenic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
924082697 1:240415940-240415962 GAATAGAAGCTGAAGGAGGCTGG - Intronic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924823962 1:247521322-247521344 GTGGAGAGGGAGAGGGAGACTGG - Intronic
1062812479 10:477316-477338 GAGGAGAGGGAGGGGGAGGGAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063453644 10:6168176-6168198 GACTAGAGGTAGTGGGAGGCTGG + Intronic
1063510630 10:6642051-6642073 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1063735284 10:8746748-8746770 GAGAAGACAGAGAGGGAGGCTGG + Intergenic
1063976681 10:11423375-11423397 GAGAAGGGGGAGAGGAAGGCTGG - Intergenic
1063999827 10:11654222-11654244 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1064001277 10:11665561-11665583 GAGGAGGAGGAGGAGGAGGCCGG - Intergenic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064416728 10:15156294-15156316 GAGAAGAATGAGAGTGAGGGGGG - Intronic
1064525233 10:16249268-16249290 TACTAGAAGGGGAGGGAGGATGG + Intergenic
1065021152 10:21502369-21502391 GAGTAGAGGGAAAGAGAGGCTGG + Intergenic
1065169106 10:23010180-23010202 GAAGGGAAGGAGAGGGAAGCTGG - Intronic
1065184260 10:23156894-23156916 AGGGAGAAGGAGCGGGAGGCAGG + Intergenic
1065267442 10:23992439-23992461 GAGTAACAGGAGAGGGATGGAGG + Intronic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065641560 10:27787505-27787527 GAGTAGAAGGATAGAGCGGTGGG - Intergenic
1065645196 10:27826687-27826709 GAGGATGTGGAGAGGGAGGCAGG - Intronic
1065728754 10:28691662-28691684 GGGAAGAGGGAGAGGGAGGGAGG - Intergenic
1065840194 10:29695955-29695977 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1065866467 10:29919286-29919308 GAGGAGAAGGAGAAGAAAGCAGG - Intergenic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066134155 10:32426672-32426694 GAGTAGAGAGAGAGGGGGGTGGG + Intergenic
1066340721 10:34530163-34530185 GAGAAGGTGGAAAGGGAGGCAGG + Intronic
1066346191 10:34589044-34589066 TAGTAGAAAGAGAGAGAGACAGG - Intronic
1066626822 10:37415536-37415558 GAGGAGAAGGAGGGGCAGGAAGG + Intergenic
1067462823 10:46470429-46470451 AAGTGGAAGGAGAGAGAGGTTGG - Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067556218 10:47274875-47274897 GAGTAAAAGGGGAGGCAGGGTGG + Intergenic
1067624371 10:47914208-47914230 AAGTGGAAGGAGAGAGAGGTTGG + Intergenic
1067662094 10:48243788-48243810 GAGTAGAAAGAAAGGCAGGAAGG + Intronic
1067687496 10:48475975-48475997 GAGTAGAAGGAAAGAAAGGGTGG - Intronic
1067694693 10:48526325-48526347 GAGTTAAAGGAGAGGGAGGGAGG - Intronic
1067780812 10:49205459-49205481 GAGCTCAAGGAGAGGGAGGAAGG - Intergenic
1067991526 10:51218866-51218888 GAGAAGAAGGGGAGGAAGGAAGG + Intronic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068715583 10:60184211-60184233 GAGAAGAGGGAAAGGTAGGCAGG + Intronic
1068775269 10:60862103-60862125 GAGAAGAAAGAGAGGAAGGAAGG - Intergenic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1069578063 10:69544798-69544820 GAGTCGAAGGGGAGGGAGAGCGG - Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1069891143 10:71653143-71653165 ATGTGGCAGGAGAGGGAGGCTGG - Intronic
1069913210 10:71772287-71772309 GAATAGAAGGAGAGGGTGATAGG - Intronic
1069957875 10:72062791-72062813 GAGGAGGAGGAGGGCGAGGCAGG - Exonic
1070358027 10:75659339-75659361 GAGAGGAAAGGGAGGGAGGCAGG - Intronic
1070367614 10:75751333-75751355 GGGGAGAGGGAGAGGGAGACTGG + Intronic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1071805840 10:89119893-89119915 GAGTGAAAGGAGAGTGAGGAGGG - Intergenic
1071984808 10:91039630-91039652 GAGTGGGAGGAGTGGGTGGCAGG + Intergenic
1072019378 10:91383130-91383152 GAGTAGAAGGAGGATGAAGCAGG - Intergenic
1072161204 10:92768614-92768636 GAGATGAGAGAGAGGGAGGCAGG + Intergenic
1072195733 10:93116027-93116049 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072792948 10:98332014-98332036 GAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072930763 10:99659755-99659777 GAGCAGACGGAGCGGGAGCCTGG + Intronic
1072999510 10:100276505-100276527 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1073125053 10:101144020-101144042 GTGTAGAAGGTGAGGGAAGGAGG - Intergenic
1073132590 10:101199579-101199601 GAGTAGTGGTTGAGGGAGGCAGG + Intergenic
1073255619 10:102149154-102149176 TAGTAGGAGGAGAGTGAGGCAGG - Intronic
1073480334 10:103782658-103782680 GGGGAGAAGGGGAGGGAGGTGGG + Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073597706 10:104817372-104817394 GAGGAGGAGGAGGGGGAGGAAGG - Intronic
1073662624 10:105493619-105493641 GAGTAGATGGAAAGGGAGGATGG + Intergenic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1074203646 10:111261342-111261364 GAGTAGCAGGAGGGGGAGCTGGG - Intergenic
1074321340 10:112406010-112406032 GAGGAGATGGAAAGAGAGGCAGG + Intronic
1074514201 10:114149699-114149721 GAATGGAAGGAAAGGGAGGAAGG + Intronic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1074691336 10:116007335-116007357 GACAAGTAGGAGAGGGAGGAGGG + Intergenic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1074746180 10:116534837-116534859 GGGTAGAAGGAGGGTGAGGATGG - Intergenic
1074763707 10:116685699-116685721 ATGTAGAAAGAGAGGGAGGGTGG + Intronic
1074776800 10:116773136-116773158 GAGGAAAAGGAGTGGGAGGAAGG - Intergenic
1074885440 10:117689327-117689349 GGGAAGAAGGGGAGGGAGGTGGG + Intergenic
1075023298 10:118966764-118966786 GTGTAGGAGGAGAGGGTGTCTGG + Intergenic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075389123 10:122079639-122079661 GAGGAGCAGGACAGAGAGGCTGG + Intronic
1075753227 10:124791310-124791332 GAGTAGGAGGGGAGGGATGTGGG - Intronic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076241768 10:128914033-128914055 GAGTAGAGGGAGAACGGGGCAGG + Intergenic
1076393397 10:130120641-130120663 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
1076499747 10:130928364-130928386 GAGCTGTAGGAGAGAGAGGCTGG + Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077204078 11:1333189-1333211 GAGTGGAGGGAGAGGGCGGGAGG + Intergenic
1077272198 11:1686671-1686693 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077272289 11:1686946-1686968 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077338454 11:2015731-2015753 GAGTGGCAGGAGAGAAAGGCAGG - Intergenic
1077392593 11:2306996-2307018 GAGAAGAAAGAGGGGGAGGGTGG + Intronic
1077724693 11:4662274-4662296 GAGAGGAAGGAGAGGGAGGGAGG - Intergenic
1077837661 11:5938452-5938474 GGGAAAAAGGAGAGAGAGGCGGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078963338 11:16305927-16305949 GTATAGAAGGTGAGGGATGCTGG + Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1078987034 11:16607004-16607026 GAGGAGGAGGAGCGGGAGGAGGG - Intronic
1079539028 11:21549917-21549939 GAGTGGAAAAAGAGTGAGGCAGG + Intronic
1079662919 11:23064227-23064249 GAGTAGAGTGGGAGGGAAGCAGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079826421 11:25201034-25201056 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1080103760 11:28490032-28490054 GAATAGAAGGAGAGGGAAGAAGG + Intergenic
1080151121 11:29053256-29053278 GGAGAGAAGGAGAGGGAGGGAGG + Intergenic
1081401586 11:42649198-42649220 GAAAAGAGGGGGAGGGAGGCTGG - Intergenic
1081526984 11:43934111-43934133 GAGGAGAGGGAGAGAGAGACAGG - Intronic
1081665001 11:44911615-44911637 GAGGAGGGGGAAAGGGAGGCTGG - Intronic
1081683761 11:45027101-45027123 GAGAGGGAGGAGAGGGAGACAGG - Intergenic
1081720548 11:45285681-45285703 GGGTAAGAGGAGAGGGAGGCTGG - Intronic
1081872827 11:46391194-46391216 GGGTGGAGGGAGAGGGAGGGCGG + Intergenic
1081877866 11:46422571-46422593 GAAAAGAATGAGAGGGAGCCAGG + Intronic
1082060545 11:47856317-47856339 GATTAGCAAGAGAGGGAGGAGGG - Intergenic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1082771559 11:57211558-57211580 GAGGAGATGGAAGGGGAGGCGGG - Intergenic
1083055656 11:59816631-59816653 GATTAGAATGAGAGGCAGGTTGG + Intergenic
1083158669 11:60841363-60841385 GGGTAGAAGAAGAGGGACGTGGG + Intergenic
1083270464 11:61569714-61569736 GAGAGGAAGGACAGGGAGGAAGG + Intronic
1083300106 11:61735679-61735701 GAGGACAGGAAGAGGGAGGCAGG - Intronic
1083310394 11:61780841-61780863 GAGAGGGAGGGGAGGGAGGCAGG - Intronic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083802237 11:65053367-65053389 GAGGAGAGGGAGAGGTGGGCAGG + Intronic
1083802763 11:65056353-65056375 GAGTAGAATGAGAGAGGGGAAGG - Intronic
1083857722 11:65401356-65401378 GGGAAGCAGGGGAGGGAGGCAGG - Intronic
1083857733 11:65401382-65401404 GAGGGGCAGGGGAGGGAGGCTGG - Intronic
1083864204 11:65444863-65444885 GAATGGAAGGCGAGGCAGGCGGG + Intergenic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084117855 11:67052392-67052414 GAGTGGCAGGAGGGGCAGGCAGG + Intergenic
1084393225 11:68892060-68892082 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393247 11:68892137-68892159 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393258 11:68892177-68892199 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393269 11:68892216-68892238 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393281 11:68892256-68892278 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393293 11:68892296-68892318 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393305 11:68892336-68892358 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393317 11:68892376-68892398 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393329 11:68892416-68892438 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393341 11:68892456-68892478 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393353 11:68892496-68892518 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393365 11:68892536-68892558 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393377 11:68892576-68892598 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393389 11:68892616-68892638 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393399 11:68892656-68892678 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393408 11:68892696-68892718 GAGGAGAAGGGGAGCGAGGCTGG + Intronic
1084511259 11:69605707-69605729 GGGTGGAAGGAGAGGGGAGCAGG - Intergenic
1084615622 11:70233985-70234007 GTGTAGCAGGAGAGAGAAGCAGG - Intergenic
1084617252 11:70244794-70244816 GAGGAGGAGGAGAGGGAAGGAGG + Intergenic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1085034561 11:73292277-73292299 GAAAAGAAGAAGAGGGAAGCGGG + Intronic
1085116892 11:73937665-73937687 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
1085294457 11:75423249-75423271 GAGAAGAAGGTAGGGGAGGCAGG + Intronic
1085489362 11:76900316-76900338 GAGAAGGTGGAAAGGGAGGCAGG + Intronic
1085754313 11:79191130-79191152 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1085796891 11:79549959-79549981 GAGTGGACAGAGAGGCAGGCAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086407727 11:86513170-86513192 GATAAGAAGGAGAGAGAGGAGGG + Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087245423 11:95829985-95830007 ATGTAGAAGGAGAGGGAGTTAGG + Intronic
1088591957 11:111411226-111411248 GAGTAGAAGGAGAAAGGAGCAGG - Intronic
1088591962 11:111411262-111411284 GAGTAGAAGGAGACAGGAGCAGG - Intronic
1088900834 11:114115805-114115827 GGGGAGAAGGACAGAGAGGCAGG + Intronic
1089123179 11:116155496-116155518 GAGGAGGAGGAGAGGAAGGAGGG + Intergenic
1089290279 11:117433480-117433502 CAGTAGAGGGAGAGGAGGGCTGG + Intronic
1089317325 11:117600870-117600892 GAGGAGAAGGAGGGGTAGGGAGG + Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089452973 11:118609988-118610010 GGGGCGAAGGAGAGGGAGGCTGG - Intronic
1089513791 11:119018683-119018705 GAGGAGGAGGAGGAGGAGGCTGG + Exonic
1089633118 11:119795852-119795874 GCAGAGAAGGAGGGGGAGGCAGG + Intergenic
1089676176 11:120091407-120091429 GGGTAGAAGGAGAGGGAAGGTGG - Intergenic
1089773715 11:120821355-120821377 GAGGAGCAAGAGAGGGAGGCAGG + Intronic
1089784969 11:120901247-120901269 GAGGAGAAGGCGAGGTGGGCTGG - Intronic
1089966306 11:122656738-122656760 GAGTAGGAGGAGCGGGAGCGTGG + Intronic
1090305031 11:125683974-125683996 GAGTAGAGGGAGAGGTTGGAAGG - Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090549707 11:127806477-127806499 GGGTTGAAGGAGGGGGAGGGAGG - Intergenic
1090585336 11:128205996-128206018 GAGGAGCAAGAGAGGGAGGAGGG + Intergenic
1090703189 11:129314701-129314723 GAGGGGAAGGAAAGGAAGGCAGG - Intergenic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090990397 11:131812225-131812247 GGGGAGAATGAGAGGGAGGAAGG - Intronic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091358450 11:134956154-134956176 GGGTAGGAGGAGAGAGGGGCAGG + Intergenic
1202821438 11_KI270721v1_random:70913-70935 GAGTGGCAGGAGAGAAAGGCAGG - Intergenic
1091686691 12:2567506-2567528 GAGGAGGCAGAGAGGGAGGCAGG - Intronic
1091696454 12:2631263-2631285 GAGGAGGAGGAGAGAGAGGAAGG - Intronic
1091832304 12:3558239-3558261 GAGGAGAAGGAAGGGGAGGAAGG - Intronic
1091838485 12:3602610-3602632 GAGTAGAAGGATGGGGTGGGAGG - Intergenic
1091842020 12:3628141-3628163 GAGTTGGGGGAGAGGGAGGGAGG - Intronic
1091883744 12:4001150-4001172 GAGTGAAAGGAGAGGGTGGGTGG - Intergenic
1091907349 12:4199891-4199913 GAGGAGAAGGTGAGGAAAGCGGG + Intergenic
1092065876 12:5589333-5589355 GGGTGGCAGGAGAGGGAGACAGG + Intronic
1092191831 12:6526865-6526887 GAGGAGAGGGAGAGGGAAGGTGG - Intronic
1092231586 12:6778558-6778580 AAGGGGAAGGTGAGGGAGGCTGG - Intergenic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092905288 12:13095706-13095728 GGGTAGGAGGAGAGGGAGGAGGG - Intronic
1093204661 12:16232971-16232993 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1094083817 12:26566430-26566452 GAGGAGAAGGAGAGGAAAGAGGG + Intronic
1094209245 12:27873338-27873360 GGGGAGAGGGAGAGGGAGACCGG - Intergenic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095209619 12:39477067-39477089 GAGTAGAATGGGAGGCAGGTTGG - Intergenic
1095253947 12:40011640-40011662 GAGGAGACGGGGAGGGAGGAAGG - Intronic
1095301932 12:40594648-40594670 GAGTAGAAGAGTAGGGAGGAGGG - Intergenic
1095587018 12:43860712-43860734 GAGGAGAAGTGGAGGGAGGTGGG + Intronic
1096031303 12:48417730-48417752 TACTAGAGGGAGAGGGAGGGAGG - Intergenic
1096208315 12:49741922-49741944 GAGGAGAAGGAGCGGGAGAAAGG - Exonic
1096312268 12:50531676-50531698 AAGTGGAAGTAGAGGCAGGCGGG + Intronic
1096463578 12:51836263-51836285 GAGGAGGAGGAGAGGAAGGTAGG + Intergenic
1096529608 12:52234457-52234479 AAGGAGAACGTGAGGGAGGCGGG - Intronic
1096604939 12:52757933-52757955 GAGGGGCAGGAGAGGGAGGAGGG - Intergenic
1096640122 12:52987714-52987736 GAGAAGAAAGAAAGGGAGGAAGG + Intergenic
1096695583 12:53346077-53346099 GGGGAGGAGGAGAGGGAGCCAGG + Intergenic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096750905 12:53758259-53758281 GAGGAGAAATAGAGGAAGGCAGG - Intergenic
1097014220 12:55974048-55974070 GAGGAGAAGGAGGGGCAGGAGGG + Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098060893 12:66561198-66561220 GAGTGGAAGGAAAGTGAGGATGG + Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098460794 12:70731024-70731046 GAGAGGAAGGAGAGAGAGGAAGG + Intronic
1098605327 12:72382418-72382440 GAATGGAGGGAGAGGGAGACAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098892038 12:76019056-76019078 GAGGAGAAGGAGAGAGAAGAGGG + Intergenic
1099286101 12:80715977-80715999 GAGCAGAAAGAGAGGGAGAAAGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100023209 12:90096736-90096758 AAGTAGTAGGACAGGCAGGCAGG + Intergenic
1100098749 12:91076588-91076610 GAGGAGAAGGAGACGGAGAAGGG + Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100339589 12:93665684-93665706 GAGTAGGGGGAGAGGAAGGCTGG - Intergenic
1100550689 12:95644204-95644226 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1100550694 12:95644213-95644235 GAGAAGAAGGAGGGGAAGGAGGG - Intergenic
1100948660 12:99819894-99819916 GATGAGAAGAAGTGGGAGGCAGG + Intronic
1101252799 12:102951785-102951807 GAGAAGAAGGAGGGGGAAGGGGG - Intronic
1101438293 12:104682927-104682949 GAGAAGAAGGACAGAGAGTCAGG - Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101901192 12:108792395-108792417 GAGGAGACGGAAAGGGAGGAGGG - Exonic
1101941908 12:109105691-109105713 GGGGAGAAAGAGAGGTAGGCAGG - Intronic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102177453 12:110886635-110886657 GGGTGGGAGGAGAGGGAGGTTGG - Intronic
1102241762 12:111328986-111329008 GAGGAGAGGGAGAGGGAGAGAGG - Intronic
1102353240 12:112210438-112210460 GAGGTGAGGGACAGGGAGGCAGG - Intronic
1102517512 12:113459834-113459856 GAAGAGGAGGGGAGGGAGGCAGG - Intergenic
1102556076 12:113727391-113727413 GAGAAGAAAGAAAGGGAGGAAGG - Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102983712 12:117262397-117262419 GGGTGGAAGGAGAGAGAGGGAGG + Intronic
1103131954 12:118477026-118477048 GAGGAGAAAGAAAGGGAGGAAGG - Intergenic
1103135009 12:118499459-118499481 GAAAAGAAGGAGAGGAAGGAAGG - Intergenic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103512351 12:121484105-121484127 AGGTGGGAGGAGAGGGAGGCGGG - Intronic
1103886790 12:124208446-124208468 GGGGAGGAGGAGAGGGAGCCAGG - Intronic
1103954340 12:124567898-124567920 GAGAAGAGGGAGGGGAAGGCTGG - Intergenic
1104903195 12:132200054-132200076 GAGTAGAAGCACAGGGAGGCTGG + Intronic
1105437576 13:20391223-20391245 GGGTAGGGGGAAAGGGAGGCGGG + Intergenic
1105564289 13:21528909-21528931 GAGTAGAGGGAGAGAGAGAATGG + Intronic
1105892715 13:24693334-24693356 GGGAAGGAGGAGAGGGAGGGAGG - Intronic
1106271628 13:28159774-28159796 GAGTAGGAGGAGGGTGAGGAAGG + Intronic
1106345379 13:28871949-28871971 GAGGAGGCCGAGAGGGAGGCAGG + Intronic
1106360754 13:29028486-29028508 GAGTGGAAGGAGAGGAGGGCAGG - Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106560944 13:30845746-30845768 GGGCAGAGGAAGAGGGAGGCAGG + Intergenic
1106593387 13:31116934-31116956 GGGCAGAGGGAGAGGGAGGAGGG + Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106840859 13:33683665-33683687 GGGGAGAAGGTGAGGGAGGTGGG + Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107131388 13:36900067-36900089 GAGTAGAAGGAAAAGAAGGCAGG - Intronic
1107329053 13:39277866-39277888 GGGGAGAAGGAAAGGGAGGGTGG - Intergenic
1107336321 13:39359622-39359644 GAATACAAGGAGAAGGAGGTAGG + Intronic
1107408655 13:40138668-40138690 GGGAAGAACAAGAGGGAGGCAGG + Intergenic
1107562527 13:41571344-41571366 GGGGAGAGGGAGAGGGAGACGGG - Intronic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108637094 13:52346049-52346071 GACGAGATGGATAGGGAGGCTGG - Intergenic
1108790273 13:53961529-53961551 GAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1108926746 13:55758258-55758280 GAGAAGTAGGATTGGGAGGCTGG - Intergenic
1109261031 13:60145179-60145201 GAAAGGAAGGAGAGTGAGGCTGG - Intronic
1110171622 13:72507566-72507588 GAGAAGTAGGAGTGGGAAGCTGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111048420 13:82846759-82846781 GAGGAGGAAGGGAGGGAGGCAGG + Intergenic
1111093443 13:83477404-83477426 GAGAAGGGAGAGAGGGAGGCAGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111275006 13:85936564-85936586 GAAAAGAAGGAGAGGAAGGAAGG - Intergenic
1111640515 13:90963851-90963873 GAGGAGAAGGAGAGAGATGGGGG - Intergenic
1111654203 13:91131988-91132010 GGGAAGCAGGAGAGGGAAGCAGG + Intergenic
1112108998 13:96273964-96273986 GAGGAGGAGGGGAGGGAGGGAGG - Intronic
1112401931 13:99085820-99085842 ACATGGAAGGAGAGGGAGGCCGG + Intronic
1112515416 13:100049044-100049066 GAGCAGAAGCAAGGGGAGGCAGG + Intergenic
1112998205 13:105599878-105599900 GAGTAGCAGGAGAGAAATGCTGG - Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113346390 13:109482526-109482548 GGGAAGAGGGAGAGGGAAGCAGG + Intergenic
1113641763 13:111962708-111962730 GACTTGAAGGAGGAGGAGGCTGG + Intergenic
1113657563 13:112077958-112077980 GGGTAGAAGCACATGGAGGCAGG + Intergenic
1113754778 13:112803810-112803832 GAGGGGAAGGAGAGGAAGGAGGG - Intronic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1114554105 14:23551649-23551671 GAGGAGGAGGAGGAGGAGGCAGG - Exonic
1114671859 14:24415761-24415783 CAGGAGAAGGAAAGGGAGACAGG - Exonic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115292792 14:31791610-31791632 GAGGAGCAGGAGAGAGTGGCTGG + Intronic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115428384 14:33287605-33287627 AAGTAGTAGGAGAGGGATGCAGG - Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1115718172 14:36128848-36128870 GGGTGGAAGGAGAGTGAGACTGG + Intergenic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1115973274 14:38969557-38969579 GAGTTGAATGATAGGAAGGCTGG + Intergenic
1115990875 14:39148210-39148232 GAGAAGCAGAAGAGGGATGCTGG + Exonic
1116110777 14:40577889-40577911 GAGGAGGAGGAGAGAGAGGGTGG + Intergenic
1116524775 14:45891121-45891143 GAGGAGCAGGAGAGAGAGGGAGG - Intergenic
1116788943 14:49318910-49318932 GAGGAGAAGGGAAGGGAGGGAGG + Intergenic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117340041 14:54784725-54784747 GAGGACAAGGAGGGGTAGGCAGG + Intronic
1117732795 14:58740777-58740799 GACTGGAAGGAGTGGGAGGCAGG + Intergenic
1118182756 14:63509615-63509637 GAGTAGGAGGAGGGGCAGTCTGG - Intronic
1118339904 14:64885938-64885960 GAATTGAAGGAGAGGGAAACTGG - Intergenic
1118773738 14:68960184-68960206 GAGGAGGAGGAAGGGGAGGCAGG + Intronic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1119004410 14:70910145-70910167 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1119055714 14:71417652-71417674 GAGGAGGAGGAAGGGGAGGCAGG + Intronic
1119102809 14:71895913-71895935 GAGTAGGAGGAGAGTGAGGTTGG - Intergenic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119408599 14:74413981-74414003 GACCAGAAGGAGAGGGTGGCAGG + Intronic
1119623754 14:76152460-76152482 GAGTAGGAGGTGGGAGAGGCAGG - Intronic
1119993647 14:79227849-79227871 GAGAAGAAAGAGAGGAAGGGAGG - Intronic
1120345695 14:83286919-83286941 GAGTAGTTGGAGGGGGAGGAGGG + Intergenic
1120367751 14:83592047-83592069 GAATAGAAGGAGAGGAAGGAAGG - Intergenic
1121153669 14:91663074-91663096 GAGGAGAAGGAGGTGGAGGAGGG - Intronic
1121281679 14:92703534-92703556 GGGGAGAAGGTGAGGAAGGCTGG + Intergenic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121974405 14:98389651-98389673 GAGTAGTGGGAGAGGGAGGGAGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1121992533 14:98573635-98573657 GGGTAGAAGGGAAGGGAGGGTGG + Intergenic
1122306885 14:100772162-100772184 GAGTGGGAGAACAGGGAGGCTGG - Intergenic
1122451077 14:101808094-101808116 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1122537909 14:102479093-102479115 GACTAAAAGAAGAGCGAGGCAGG + Intronic
1122961152 14:105094079-105094101 GGGTTGGAGGAGATGGAGGCAGG - Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1124013840 15:25860433-25860455 GAATAGAAGGAGGAGGAGGCTGG - Intronic
1124044608 15:26137446-26137468 GAAAAGGAGGAGAGGGAGGCAGG - Intergenic
1124179225 15:27457049-27457071 AAGTAGAAGGAGCTGGAGGAGGG + Intronic
1124357621 15:29008225-29008247 GGCTAGAAGGAGAGGGAAGGGGG + Intronic
1124548146 15:30651916-30651938 GGGAAGAAGGGGAGGGAGGAAGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125310963 15:38377789-38377811 GAGAAGAGGAAGAGGAAGGCTGG + Intergenic
1125330639 15:38578990-38579012 GAGTAGGGGGTGAGGGTGGCAGG + Intergenic
1125359524 15:38850347-38850369 GAAGAGAAGAGGAGGGAGGCAGG + Intergenic
1125651036 15:41318064-41318086 TATTAGAGGGAGAGAGAGGCTGG + Intronic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125694199 15:41621693-41621715 GGGGGGAAGGAGAGGGTGGCGGG + Intronic
1125723745 15:41857498-41857520 GGGTAGAAAGTGAGGTAGGCAGG + Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126321471 15:47428926-47428948 GAGGAGGAAGAGAGGGAGGGAGG + Intronic
1126339841 15:47627178-47627200 AAGTAGGAGGAGTGGGAGGAAGG + Intronic
1126496381 15:49295156-49295178 GAGAAGAAGGAGGGGAAGGAGGG + Intronic
1126990895 15:54374392-54374414 GAGGGGCATGAGAGGGAGGCCGG - Intronic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127114090 15:55706781-55706803 GAGGAGAGGGAGAGCGAGGCAGG + Intronic
1127234910 15:57038451-57038473 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1127258450 15:57310262-57310284 GGGTAGAAGAAGAGGGAGACGGG + Intergenic
1127322775 15:57863662-57863684 GAGCGGAAGTAGAGGCAGGCAGG + Intergenic
1127582339 15:60349830-60349852 GAGGGGAAGGAAAGGGAGGGAGG + Intronic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128230128 15:66028992-66029014 GACTACAAGGAGAGAGAGGAGGG + Intronic
1128330416 15:66751935-66751957 GAGTAGGAGGAAAGGCAGGCTGG - Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1129467419 15:75731785-75731807 GAGCAGAAGGAACGGGAGGGCGG - Intergenic
1129519769 15:76178287-76178309 GAGAAGAAGGTGAGAGAAGCTGG + Intronic
1129624151 15:77179292-77179314 GAGAAGAAGTAGAGCGTGGCGGG + Exonic
1129695273 15:77737432-77737454 GGGAGGAAGGAGAGGGAGGAAGG + Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1129997116 15:80016514-80016536 GTGTGGAAGGAGAGGCAGGGGGG + Intergenic
1130040831 15:80404319-80404341 GAGGAGGAGGAGAGAAAGGCGGG + Intergenic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1130049074 15:80468258-80468280 GGGGAGGAGGAGATGGAGGCTGG - Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130387382 15:83423568-83423590 GAGCAGAAAGAGAGGGAGAGAGG + Intergenic
1130415895 15:83694340-83694362 GACCAGGAGGAGGGGGAGGCTGG + Intronic
1130721021 15:86386087-86386109 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1130788161 15:87123252-87123274 GGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131366500 15:91846308-91846330 GGGGAGAGGGAGAGGGAGGGAGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131701627 15:94942985-94943007 GAGGAGGAGGAAAGGGAGGAGGG + Intergenic
1131915697 15:97263532-97263554 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132083290 15:98885393-98885415 GAGGAGAAGGAAAGGGAGAGGGG - Intronic
1132102542 15:99034804-99034826 GAGTAGGAGAAGAGAGAGGTGGG + Intergenic
1132183420 15:99780429-99780451 GAGATGGAGGAGAGGGAGGAGGG + Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132344037 15:101096841-101096863 GGGTAGGAGGAGAGGGAGGATGG + Intergenic
1132367017 15:101265057-101265079 GAGCAGCATGAGAGGAAGGCCGG - Intergenic
1132420238 15:101659592-101659614 TAGGAGATGGAGAGGGAGACAGG - Intronic
1132435015 15:101793052-101793074 GAGATGGAGGAGAGGGAGGAGGG - Intergenic
1132588478 16:716201-716223 GAGTGGAGGGAAGGGGAGGCCGG + Intronic
1132664723 16:1076199-1076221 GGGGAGAGGGAGGGGGAGGCGGG - Intergenic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133431674 16:5742353-5742375 GAGAGGAAGGAGAGGAAGGAAGG - Intergenic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133532395 16:6667111-6667133 GGGTTGGGGGAGAGGGAGGCAGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133742293 16:8660818-8660840 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1133890937 16:9877859-9877881 GAGTTGGGGGAGAGGGAGGCAGG - Intronic
1133978510 16:10617246-10617268 AAGTAGGAGGAGTGGGAGGTAGG - Intergenic
1134028753 16:10975044-10975066 GAGGAGAAGTAGAGGAGGGCTGG + Intronic
1134122798 16:11596693-11596715 GAGCAGGGGGAGAGGGAGGAGGG + Intronic
1134356088 16:13483611-13483633 GATTAGAGGGAGAGGAGGGCTGG - Intergenic
1135118061 16:19740391-19740413 GAATGGAAGGGGAGTGAGGCTGG + Intronic
1135130738 16:19851856-19851878 GAGGAAAAGGGGAGGGAAGCAGG - Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135727700 16:24869787-24869809 GAAGAGAAGTAGAGGAAGGCAGG - Intronic
1135784897 16:25340041-25340063 GAGGAGCAAGAGAGGGAGGGGGG - Intergenic
1135798939 16:25474642-25474664 GAGCTGAAGGAGAGGTAGCCTGG - Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135976775 16:27113634-27113656 GAGCAGGAGGAGAGAGAGGTGGG + Intergenic
1136236891 16:28919850-28919872 GAGGAGAAGGAGCGGGAGCTGGG - Exonic
1136540276 16:30924551-30924573 GAGTAGAGAGAGGGTGAGGCTGG - Intronic
1136565772 16:31069306-31069328 GAGTGGGAGGTGAGGTAGGCAGG - Intronic
1136577051 16:31131168-31131190 GGGGAGAAGGGGCGGGAGGCAGG - Exonic
1137386460 16:48047351-48047373 GAGGAGAAGGAGGTGGAGGATGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137954416 16:52814589-52814611 GGCTAGAAGGAGAGAGAGTCTGG - Intergenic
1137955419 16:52824511-52824533 GAGGGGAAGGTGAGGGAGGGAGG - Intergenic
1138005080 16:53326817-53326839 GGGTAGAATTAGAGGGAGGAAGG - Exonic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138495956 16:57409609-57409631 GAGGAGAAGGAGACGGATTCAGG + Intronic
1138610481 16:58119753-58119775 CAGTAGATGGCGAGTGAGGCGGG - Intronic
1139055527 16:63179074-63179096 GAGTGAAAGGAGAGGGGGGGGGG + Intergenic
1139296638 16:65907164-65907186 GAGTAGAAAGGGAGGTAGGGTGG + Intergenic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139394583 16:66630320-66630342 GGGGAGAGGGAGAGGGAGGGGGG - Intronic
1140153783 16:72401174-72401196 GAGGAGAGGGAGAGGGAGGGGGG + Intergenic
1140197723 16:72869097-72869119 GAGAAGACGGAAAGGAAGGCAGG + Intronic
1140306131 16:73804911-73804933 GAGGGGAGGGAGAGGGAGGGAGG + Intergenic
1140874824 16:79141084-79141106 GAGTAGAATGGGAGGCAGGTTGG - Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141211655 16:81986447-81986469 GAGGAGAAGGAGAGGGAATAGGG + Intergenic
1141635674 16:85312745-85312767 GAGGAGAAGGAGGGGGAGGAAGG + Intergenic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141703583 16:85653208-85653230 GAGGAGGAGGAGGGGGAGGGGGG - Intronic
1141797873 16:86286899-86286921 GGGCAGAAAGACAGGGAGGCGGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142245824 16:88969624-88969646 GAGCCGAGGGAGAGGGGGGCGGG + Intronic
1142254319 16:89006684-89006706 GAAGAGATGGAGAGGGAGGGAGG - Intergenic
1142426767 16:90005752-90005774 GAGTAGAAGAAGGGGCAGGATGG + Exonic
1142513150 17:410502-410524 GAGGAGGAGGAGCGGGAGGGCGG + Exonic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1143297758 17:5883880-5883902 AAGCAGGAGGAGATGGAGGCGGG - Intronic
1143352384 17:6298219-6298241 TGGTAGAAGAGGAGGGAGGCGGG - Intergenic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143483001 17:7238143-7238165 GAGTAGAAGGGGCCGGAGGGCGG - Intronic
1143510595 17:7393442-7393464 AAGTAGAAGGAGTGGGAGGTTGG - Intronic
1143591410 17:7887654-7887676 GATTAGAAGAAGAGAGGGGCGGG + Intronic
1143608253 17:8003148-8003170 GAGCAGCAGGAGCGGGAGCCGGG - Exonic
1143638859 17:8183845-8183867 GAGGAGGAGGAGACGGAGCCGGG - Intergenic
1143855417 17:9844453-9844475 GGGTGGAAGAAGAGGGAGGGTGG + Intronic
1143947431 17:10605475-10605497 GAGAAGGAGGAGGGGGAGGGAGG + Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1145026902 17:19475322-19475344 GGGGAGAGGGAGAGGGAGGGGGG - Intergenic
1145722661 17:27088352-27088374 GAGAAGGAAGAGAGGGAGGTAGG - Intergenic
1146010513 17:29190833-29190855 GACTAGCAGGCCAGGGAGGCAGG - Intergenic
1146634520 17:34494256-34494278 GGGCAGAAGGCGAGGGAGCCTGG + Intergenic
1147315332 17:39617709-39617731 GAGGAGAAGGAGCGAGTGGCGGG - Intergenic
1147590905 17:41682748-41682770 GAGGGGAAGGAGTGGGAAGCAGG + Intergenic
1147622154 17:41875402-41875424 GGGGAGAGGGAGAGGGAGGGGGG - Intronic
1147647665 17:42043468-42043490 GAGTTGATGGGGAGGCAGGCTGG + Intronic
1147971202 17:44219795-44219817 GAGGAGGAGGAGCGGGAGGGGGG + Intronic
1148119176 17:45197644-45197666 GAGGAGGAGGAGAGGGAGATGGG + Intergenic
1148145564 17:45362444-45362466 GACTAGAAGGAGGGGGACCCCGG - Intergenic
1148493738 17:48039516-48039538 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1148782812 17:50130942-50130964 GACTAGGAGGTGAGGGAGGAGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148797877 17:50205911-50205933 GGGGAGAATGAGGGGGAGGCTGG - Intergenic
1149038389 17:52158932-52158954 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1149414321 17:56443118-56443140 GAGTAAAAGGAGAGGGAATTTGG + Intronic
1149588392 17:57809180-57809202 GAGTGGGGAGAGAGGGAGGCAGG + Intergenic
1149649810 17:58269635-58269657 GGGTGGAAGGTGAGGGAGGAGGG + Intergenic
1149663734 17:58351675-58351697 GAGAGGAAGGAGTGGGAGGGTGG - Intronic
1149798932 17:59548437-59548459 GAACAGAAGCAGAGGGAAGCAGG - Intergenic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150026545 17:61681030-61681052 GAGAAGAATGAGAGTGAAGCAGG + Intergenic
1150041245 17:61863522-61863544 GAGTCGAGGGGGCGGGAGGCGGG - Intergenic
1150152244 17:62819590-62819612 GAAGAGAAGGAGAGGAAGGATGG - Intergenic
1150612472 17:66744965-66744987 TTGTAGGAGAAGAGGGAGGCTGG - Intronic
1150652533 17:67019343-67019365 GAGGAGGAGGTGAGGGAGGAAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150822214 17:68444862-68444884 GAGAAGGAAGAGAGGGAGGGAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151050999 17:70978550-70978572 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151051009 17:70978576-70978598 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151354267 17:73549214-73549236 GAGTAGAAGGAGAGAGGAGTGGG + Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151383903 17:73743714-73743736 GAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1151410754 17:73926619-73926641 GAGGAGAAGGAGAGAGATGAGGG - Intergenic
1151479286 17:74360937-74360959 CAGTAGCAGGAGAGAGGGGCGGG + Intronic
1151883518 17:76909733-76909755 GAGTAGTGGGAGAAGGAGGCTGG + Intronic
1151914155 17:77105148-77105170 GAATAGAAGGGGAGGCAGGTTGG + Intronic
1152033765 17:77859268-77859290 GAAGAGAGGGAGAGGGAGGCAGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152265688 17:79293350-79293372 GAGGGGGAGGGGAGGGAGGCAGG - Intronic
1152400767 17:80065052-80065074 GAGGAGGGGGAGAGGGAGGAGGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152516120 17:80825914-80825936 AAGTAGACGGAGACGGAGGCTGG + Intronic
1153324624 18:3805419-3805441 GAGTTGGAGCAGAGAGAGGCTGG + Intronic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153893844 18:9541601-9541623 GAGGGGAGGGAGAGGGAGCCAGG - Intergenic
1153914244 18:9732085-9732107 GAGCTGAGGGAGACGGAGGCTGG - Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1154214184 18:12403342-12403364 GATTTGAAGGTGAGGGTGGCAGG + Intergenic
1154496495 18:14965064-14965086 GGGTAGGAGGAGAGAGGGGCAGG - Intergenic
1155255875 18:23997622-23997644 GAAAAGAAAGAGAGGGAGGGAGG + Intronic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155916340 18:31561309-31561331 GAGTAGAGGGAGACGCAGACGGG - Intergenic
1156024333 18:32634467-32634489 AAGTAGGAGGATAGGGAGGGAGG + Intergenic
1156472869 18:37388431-37388453 GAGAAGAAGGAGAGAGAAGGAGG - Intronic
1156862091 18:41849194-41849216 GGGAAGAAGAAGAGGGAGGAGGG + Intergenic
1156965379 18:43085046-43085068 GAGTAGAATGAGAAGGAAGCGGG + Intronic
1157098777 18:44711228-44711250 GAGGAGTAGGGGAGGGAGGGAGG - Intronic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157597722 18:48874095-48874117 AATTAGCAGGAGAGGGAGGCAGG + Intergenic
1157680129 18:49598546-49598568 GAGGAGAAGGAGAAAGAAGCAGG - Exonic
1157688542 18:49662410-49662432 GAAAAGAAGGTGAGAGAGGCTGG + Intergenic
1157793541 18:50555116-50555138 GAGCAGGTGGAGAGAGAGGCAGG - Intergenic
1157804074 18:50645040-50645062 GAGCAGAAGGAGAGGCCTGCAGG + Intronic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1157948509 18:52008073-52008095 TAATAGAAAGAGATGGAGGCGGG - Intergenic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158494654 18:57943471-57943493 GAGGAGAAGGAGGGAGAGGTTGG - Intergenic
1158525487 18:58209312-58209334 GAGGAGGAGGAGGGGGAGGGGGG - Intronic
1158610400 18:58935198-58935220 GAGGAGAAGGAGAGGGGAGGAGG - Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159031795 18:63239221-63239243 GAGTATAAAGAAAGGGAGGCTGG + Intronic
1159134261 18:64318619-64318641 GAGGAGAAGGAGAGATAGGGAGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159893867 18:73978622-73978644 AGATAGAAGGAGAGGGAGACAGG - Intergenic
1159915400 18:74183191-74183213 GAGGAGAAGTAGGGGGAGGTGGG - Intergenic
1159924131 18:74251520-74251542 GAGTAGAATGGGAGGCAGGTTGG + Exonic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1160011519 18:75110061-75110083 GGGAGGAGGGAGAGGGAGGCTGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160345362 18:78127910-78127932 GAGCAGAGGGCCAGGGAGGCAGG - Intergenic
1160614011 18:80109850-80109872 GAGTAGAGGGAGAGGGAACGGGG + Intronic
1160872096 19:1282280-1282302 GTGTAAAAGGAGAGGGAGAGAGG + Intergenic
1160912788 19:1482543-1482565 GAGCTGAAGGGGAGGGAGCCCGG - Intronic
1161030286 19:2054934-2054956 GAGGAGGAGGAGAGGAAGCCAGG - Intergenic
1161096428 19:2394528-2394550 GAGTAGAAACAGAGTGAGGTTGG + Intronic
1161100528 19:2419001-2419023 GAGGGGAAGGAAAGGGAGGGAGG - Intronic
1161100569 19:2419107-2419129 GAAGAGAAGGAAAGGGAGGGAGG - Intronic
1161115826 19:2495887-2495909 GAGGAGGAGGAGAGGCAGGGCGG - Intergenic
1161139763 19:2640190-2640212 GAGAAGGGGGAGAGGGAGGAAGG + Intronic
1161207064 19:3046902-3046924 GGGGAGGAGGAGAGGGAGGAGGG - Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161431476 19:4234827-4234849 GAGGAGGATGAGGGGGAGGCTGG + Intronic
1161483006 19:4519990-4520012 GAGAAGAAGGAGAGGAAGGTGGG - Intergenic
1161684825 19:5697542-5697564 GAGGAGATGGAGAGGGAAGGGGG + Intronic
1161969073 19:7566252-7566274 GAGGAGAGGGAGAGGGAGAGGGG - Intergenic
1162038169 19:7953541-7953563 GGGAAGGAGGAGAGGGAGGAGGG - Intergenic
1162071898 19:8157912-8157934 GAGGAGAAAGAGAGGAAGGAAGG + Intronic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162205554 19:9053526-9053548 GAATAGAATGAGAGGCAGGTTGG + Intergenic
1162338508 19:10076718-10076740 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1162433447 19:10643013-10643035 GAGTAGAGAGTGAGGGAGACTGG + Intronic
1162809560 19:13155746-13155768 GGGTAGAAGGAGGGGCAAGCCGG + Intergenic
1162860576 19:13503891-13503913 GAATCGTGGGAGAGGGAGGCAGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163114566 19:15181166-15181188 GAGCGGAAGGAGTGGGAGGGAGG + Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163359558 19:16837212-16837234 GAGAAGGGGGAGAGGGAGCCAGG + Intronic
1163371988 19:16906292-16906314 GAGAAGAGAGAGAGGGAGGGAGG - Intronic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1163611526 19:18304383-18304405 GAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164314955 19:24079360-24079382 GACTAGAAGGGTAGGGAGGAGGG - Intronic
1164431491 19:28192997-28193019 GAGTAGAATGGGAGGCAGGTTGG - Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164654488 19:29910502-29910524 GAGATGCAGGAGAGGGAGGGAGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164830573 19:31317168-31317190 GAGCTGGAGGGGAGGGAGGCTGG - Intronic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1164878616 19:31712005-31712027 GACTAGAAGGAGAGGGCAGAGGG - Intergenic
1165313713 19:35042426-35042448 GAGGAGATGGACGGGGAGGCAGG - Exonic
1165385392 19:35507535-35507557 GAGTTGATGGGGAGGCAGGCGGG + Intronic
1165760150 19:38316152-38316174 GAGTGGCAGGAGGGCGAGGCCGG + Intronic
1165768996 19:38367612-38367634 GAGTGGAAGGAGATGGGTGCAGG + Intronic
1165830555 19:38728400-38728422 GAGGAGGAGGAGCGGGTGGCTGG - Intronic
1165995176 19:39839006-39839028 GAGTAGATGGAGAGTCAGGCAGG - Intronic
1166123608 19:40700455-40700477 GGGCAGAAGGAAAGGGAGGAAGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166304209 19:41928447-41928469 GAGGAGAAGGCGCAGGAGGCAGG - Intronic
1166517683 19:43459793-43459815 GATTGGAAGGAGATGGAGGTGGG + Intergenic
1166536774 19:43579600-43579622 GAGTAAAATGAAAGGGAGGCCGG + Intronic
1166580661 19:43895805-43895827 GTGGAGGAGGAGAGGGAGGGAGG + Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166836695 19:45671484-45671506 GAGGAGCAGGAGAGGGGTGCAGG - Intronic
1166960287 19:46492914-46492936 GAGGAGGAGGAGGGGGAGGGGGG - Exonic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
1167148549 19:47696238-47696260 GAGTGGACGGAGAGGGTGACAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1167417990 19:49386969-49386991 GAGCAGAAGGGAAGGGAGGCGGG + Intergenic
1167621341 19:50562697-50562719 GAGGAGGAAGAGAGTGAGGCAGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167733864 19:51279303-51279325 AAGTAGAAGGAGAGGCAGCATGG + Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167785492 19:51632457-51632479 GTGCAGCAGGTGAGGGAGGCTGG - Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168307553 19:55443474-55443496 GAGGGGGAGGAGAGGGAGGGAGG + Intergenic
1168327431 19:55545440-55545462 GAAAAGAAGGAGAGAGAGGCAGG - Intronic
925034242 2:673741-673763 GAGGAGGAGGAGGGGGAGGATGG + Intronic
925462550 2:4075838-4075860 GAGAAGGAAAAGAGGGAGGCAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925902055 2:8515836-8515858 GGGAGGAAGGAGAGGGAGGAGGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926843262 2:17106024-17106046 GAGTGGATGGAGAGGTAAGCGGG + Intergenic
927532273 2:23818200-23818222 GAAGAGAGGGAGAGGGAGGGAGG + Intronic
927659517 2:24981048-24981070 GAGAAGAAGGAGGGGGAGGGGGG + Intergenic
927737035 2:25533622-25533644 AAGTAGAAAGAGAGAGAGGCAGG - Intronic
927754516 2:25698053-25698075 ACGCAGGAGGAGAGGGAGGCTGG + Intergenic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
927962711 2:27250706-27250728 GAGTGGAGGGAGAGAGAGGCAGG - Intergenic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
928105834 2:28470076-28470098 GGGGAGGAGGAGAGGGAGGAGGG + Intronic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928194602 2:29206187-29206209 GAGAAGAAAGGGAGGGAGGGAGG - Intronic
928275861 2:29899433-29899455 GAGTAGAAAGACAGAGAGCCTGG + Intronic
928325889 2:30319195-30319217 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
928536287 2:32244831-32244853 GAGGAGGAGGAGAGGGAGAGAGG + Intronic
929069209 2:38011883-38011905 GAGGAGAATGACTGGGAGGCTGG - Intronic
929072076 2:38041256-38041278 AAGTAGTAGGAGAGGAGGGCAGG - Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929334589 2:40725693-40725715 GAGAAGAAGGAGAGGCAGATAGG - Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930209004 2:48615465-48615487 AAGGAGAGGGAGAGGGAGACGGG + Intronic
930656547 2:54012931-54012953 GAGCAGAGGGAGAGGGAGAGTGG - Intronic
930773622 2:55151751-55151773 GAGTAGAAGGAAAGTTGGGCAGG + Intergenic
931205340 2:60140843-60140865 GAGGAGAAGGAGGGGGAGGGGGG - Intergenic
931668366 2:64625903-64625925 GAGAGGAAGGAGAGAGAGGATGG + Intergenic
931744734 2:65282104-65282126 GTGGAGAGGGAGAGGGAGGGAGG - Intergenic
931751904 2:65338301-65338323 AAGGAGAGGGAGAGGGAGACGGG - Intronic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931851687 2:66257956-66257978 GGATGGGAGGAGAGGGAGGCAGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932075929 2:68662971-68662993 GAGTAGAAAGAGATGTAGACCGG - Intergenic
932125422 2:69141227-69141249 ACGTAGAAGGAAAGGGAGGATGG + Intronic
932196562 2:69788885-69788907 AAGAAGGAGGAGAGGGAGGGAGG + Intronic
932583074 2:73005133-73005155 AAGTGGAAGGAGAGGGAAACAGG + Intronic
932600697 2:73123225-73123247 GGGTAGAAGGATAGAGAGCCAGG - Intronic
932624111 2:73284404-73284426 GAGGAGGAGGAGGGGGAGGAGGG + Exonic
932743550 2:74312165-74312187 GATTAGAAGTAAAGGGAGGGAGG - Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933678301 2:85077123-85077145 GCGTAGGAAGAGATGGAGGCAGG + Intergenic
934047332 2:88183591-88183613 GGGAAGAAGGAGAGCGAGGGAGG - Intronic
934159437 2:89234411-89234433 GACTTGCAGGAGATGGAGGCCGG + Intergenic
934207839 2:89948021-89948043 GACTTGCAGGAGATGGAGGCCGG - Intergenic
934213335 2:90005381-90005403 GACCTGAAGGAGATGGAGGCCGG - Intergenic
934781279 2:96971254-96971276 GGGGAGAAGGAGAGAGAGGGAGG - Intronic
934947171 2:98550327-98550349 GGGTAGGAGGATTGGGAGGCTGG - Intronic
934969176 2:98749259-98749281 GGGTAGGGGGAGAGAGAGGCAGG - Intergenic
935063252 2:99626428-99626450 GAAGGGAAGGAGAGGGAGGGAGG - Intronic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935153358 2:100460204-100460226 GAATAGAATGGGAGGTAGGCTGG - Intergenic
935580931 2:104755357-104755379 GGCTAGAAGTAGAGGGAGGAGGG + Intergenic
935681884 2:105645305-105645327 GAGTGGGAGGAGAGGGAGCGGGG - Intergenic
935803398 2:106722684-106722706 GAGGAGATGGAAGGGGAGGCAGG + Intergenic
935874761 2:107494606-107494628 GAGAAGAGGGAAAGGGAGGAAGG + Intergenic
936345443 2:111672033-111672055 GGGGAGAGGGAGAGGGAGACCGG - Intergenic
936345451 2:111672054-111672076 GGGGAGAGGGAGAGGGAGACCGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936395578 2:112125697-112125719 GAGGAGAAGGAAAGGAAGGAAGG + Intergenic
936502414 2:113076812-113076834 GATTAGAAGGTGAGGGCAGCAGG + Intergenic
936880114 2:117240286-117240308 GAGGAGAGGGAGAGGCAAGCAGG + Intergenic
937078729 2:119125468-119125490 GCAAAGAAGGAAAGGGAGGCCGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937536799 2:122898864-122898886 AAGTAAATGGAGAGGAAGGCTGG - Intergenic
937559296 2:123201669-123201691 GAGTAGTGGAGGAGGGAGGCTGG - Intergenic
937579063 2:123461451-123461473 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
937977621 2:127591354-127591376 GAGTTGCAGGACAGGCAGGCAGG + Intronic
938397949 2:130964322-130964344 GAGGAGAAGGAAAGGCAGGAGGG - Intronic
938732239 2:134155718-134155740 GGCTAGAAACAGAGGGAGGCAGG - Intronic
939117970 2:138082827-138082849 AAGTAGCAGGAGAGGGTGTCTGG + Intergenic
939135839 2:138292043-138292065 GAGTAGAAGGAGAGGAAGCTGGG + Intergenic
939206204 2:139107068-139107090 AAATAGAAAGAGAGGGAGTCAGG - Intergenic
939955529 2:148525105-148525127 AAGTAGCTGGAGAGTGAGGCAGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940306761 2:152235167-152235189 GGGAAGAAGTAGAGGGGGGCAGG + Intergenic
940636775 2:156307337-156307359 GAGGAGAGGGAGAGGGAGAAGGG + Intergenic
940696406 2:156984730-156984752 GAGGAGAAGGAAGGGGAGGAGGG + Intergenic
940809994 2:158231583-158231605 GAGGAGAGGGAGAGGGAGAAAGG - Intronic
940897356 2:159093733-159093755 GAGAAGAGGGAGGGGGAGGGGGG - Intronic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941111351 2:161421739-161421761 TAAGAGAAGTAGAGGGAGGCAGG - Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941489699 2:166127613-166127635 GAAGAGGAGGAGAGGGAGGAGGG + Intronic
941543482 2:166816036-166816058 GAATCCAAGGAGAGGGAGGTGGG + Intergenic
941622582 2:167795045-167795067 GAGTAGAAGGAGAGGTAACCCGG + Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941696199 2:168553847-168553869 GAGTAGAAGGGGAAGAAGGTGGG + Intronic
941800709 2:169656512-169656534 GAGGAGGAGGAGAAGGAGACAGG + Intronic
941940246 2:171029109-171029131 GAGTAGTAGGAGAAGCAAGCTGG + Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942211773 2:173678299-173678321 AAGGAGGAGGAGAGGGAGGGAGG + Intergenic
942266633 2:174234046-174234068 AAGTGGAAGGAGAGGAAGGAGGG - Intronic
942354858 2:175099497-175099519 GAGTAGAAGGAGAGTATGACAGG - Intronic
942398291 2:175575294-175575316 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
942509543 2:176682809-176682831 GAGGAGGAAGAGAGGGAGGGAGG + Intergenic
942800734 2:179872595-179872617 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943727341 2:191265966-191265988 GAGGGGGTGGAGAGGGAGGCAGG + Intronic
943773206 2:191741220-191741242 AAGGAGAGGGAGAGGGAGACGGG - Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944476319 2:200110417-200110439 GAGTAGTACCAGAGGGAGGTAGG - Intergenic
944635152 2:201668875-201668897 GAGAAGAAGGTGAGGGAGAGAGG - Intronic
944977830 2:205077160-205077182 GAGTAGAGAGGGAGGGAGGGAGG + Intronic
945090542 2:206172591-206172613 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945753215 2:213813998-213814020 GGGTAGGAGGAGACGGAGGTAGG + Intronic
945758394 2:213879633-213879655 GACTACAAGGAGGGGGAGGGAGG - Intronic
946049716 2:216852351-216852373 GAGTAAAAGGAGAGGAAGAGGGG + Intergenic
946124089 2:217544476-217544498 GAGTACAAGGGAAGAGAGGCTGG + Intronic
946269473 2:218578654-218578676 TAAAAGAAGGAGCGGGAGGCGGG - Intronic
946389721 2:219408305-219408327 GGCTAGGAGGAGAAGGAGGCTGG - Intergenic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946492227 2:220159960-220159982 GAGGAGTAGGAGGGGGAGGAGGG - Intergenic
946501835 2:220257332-220257354 GAGGAGACGGAGGGGGAGGGAGG + Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947006067 2:225512791-225512813 GAAAAGAAAGAGAGGGAGGGAGG - Intronic
947131127 2:226925962-226925984 GAAGAGGAGGAGAGGGAGGGAGG + Intronic
947295491 2:228626214-228626236 GAATAGAATGAGAGGCAGGTTGG + Intergenic
947333645 2:229056866-229056888 GAGGTGAAGAAGAGAGAGGCAGG + Intronic
947351249 2:229247934-229247956 GAGTAGTAAGAGAAGGAGGTGGG - Intronic
947377733 2:229513884-229513906 GAGGACAGGGAGAGGGAGGGAGG - Intronic
947448537 2:230183484-230183506 GAGAAGAAGGAGAGGGCGGGTGG + Intronic
947894780 2:233659622-233659644 GAGGAGGTGGAAAGGGAGGCAGG + Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948058870 2:235029225-235029247 GGGAAGACGGAGAGGGATGCTGG + Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948644216 2:239393609-239393631 GAGGAGGAGGAAGGGGAGGCTGG - Intronic
948658097 2:239489377-239489399 GGGGACAAGGAGGGGGAGGCAGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
948821730 2:240553258-240553280 GAGAAGACAGAGAGGGAGCCTGG - Intronic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
1168754639 20:307964-307986 GGTTGGAAGGAGAGGGAGCCTGG - Intergenic
1168841473 20:912601-912623 GAGGAGGAGGAGAGAGAGGGAGG + Intronic
1168842812 20:920686-920708 GAGTAGAATGATCAGGAGGCGGG + Intergenic
1168860308 20:1041562-1041584 AAGTTGGAGGAGAGGGAGACTGG + Intergenic
1169006194 20:2209123-2209145 GGGTAGTAGGAGAAGGTGGCAGG + Intergenic
1169087736 20:2837882-2837904 GAGTGGAAAGACAGGGAGGAAGG - Intronic
1169210872 20:3765717-3765739 GAGTGGGAGAAGGGGGAGGCAGG - Intronic
1169318495 20:4612090-4612112 GAGCAGGAGGAGAGTGATGCTGG + Intergenic
1169506463 20:6216541-6216563 GAGGAAGAGAAGAGGGAGGCAGG + Intergenic
1169541650 20:6606333-6606355 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170063516 20:12285755-12285777 GAGTAGAAGAAGAGAAAAGCAGG - Intergenic
1170456862 20:16541729-16541751 GAAAAGAAGGAGACTGAGGCAGG + Intronic
1170587049 20:17742685-17742707 GAGAAGAAGGAGGGGGAGAAGGG + Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170842222 20:19933295-19933317 GTGCAGGAGGAGAGGCAGGCAGG - Intronic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1171012050 20:21514133-21514155 GGGGAGAAAGAGAGGGAGGGAGG + Intergenic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1171369806 20:24654608-24654630 GAGAAGGAAGAGAGGGAGGGAGG + Intronic
1171390091 20:24795657-24795679 GACTGGAAAGAGAGGGAGGTTGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171720943 20:28562805-28562827 GAACAGAAGGTGTGGGAGGCAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1171956010 20:31464364-31464386 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1172139707 20:32713817-32713839 GGGTATAAGAAGGGGGAGGCTGG + Intronic
1172334858 20:34106883-34106905 GAGTAGAAAGCGCAGGAGGCTGG + Intronic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172613159 20:36266527-36266549 GAGAAGAATGAGCGGGAGGATGG + Intronic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172777111 20:37414274-37414296 GGGTAGTAGGGGAGGGAGGTAGG - Intergenic
1172798040 20:37556806-37556828 GAGGAGAAGGACAGGGAAGATGG - Intergenic
1172808886 20:37633133-37633155 GAGGAGATGGGGAGGGAGGGGGG + Intergenic
1173000001 20:39098827-39098849 GAGCAGAGGGAGGTGGAGGCAGG - Intergenic
1173002014 20:39111560-39111582 GAAGAGGAGGAGAGGGAGGAGGG + Intergenic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173404339 20:42752037-42752059 GAGTATAAGAAGAGGGAGGGAGG - Intronic
1173569476 20:44067239-44067261 GAGAAGGGGGTGAGGGAGGCAGG + Intronic
1173577188 20:44120082-44120104 GAGAAGAATGAGAGGCAGGATGG - Intronic
1173790002 20:45822401-45822423 GGGAAGAAAGAGAGGGAGGGAGG + Intergenic
1174215285 20:48911776-48911798 GAGGTCAGGGAGAGGGAGGCAGG - Intergenic
1174285422 20:49469301-49469323 AAGTAGAAAGGGAGGGAGACAGG - Intronic
1174287046 20:49481182-49481204 GAGGAGGAGGAGGAGGAGGCAGG - Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174551904 20:51368240-51368262 GAGAAGATGGAGACAGAGGCTGG - Intergenic
1174864194 20:54119858-54119880 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
1174951829 20:55050793-55050815 GATGGGAAGGAGAGGGAAGCGGG + Intergenic
1174952324 20:55055876-55055898 GAGGAGATGGAAAGGCAGGCAGG - Intergenic
1174960522 20:55151769-55151791 GAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175316766 20:58054140-58054162 GAGTAGAGAGGGAGGGAGGGAGG + Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175323565 20:58107021-58107043 GCCTGGAAGGAGAGTGAGGCAGG - Intergenic
1175711629 20:61225923-61225945 GTGTCGGAGGAGAGGGAGGGAGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1175901223 20:62360580-62360602 GGGTAGAAGGATAGGTAGGTGGG + Intronic
1175972276 20:62692666-62692688 GTGTAGAGGAAGAGGGAGGGAGG + Intergenic
1176016811 20:62938136-62938158 GAGTAGAAGGAGGCAGAGGTGGG - Exonic
1176078861 20:63261681-63261703 GAGGAGAGGGAGAGAGAGGGAGG - Intronic
1176088748 20:63309729-63309751 GAGTAGCGGGAGTGGGGGGCAGG - Intronic
1176090806 20:63317866-63317888 GAGGAAGAGGAGAGGGGGGCGGG - Intronic
1176267970 20:64220685-64220707 GAGGGGAAGGAGAGGGAGAGGGG - Intronic
1176654103 21:9574553-9574575 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1176908871 21:14538324-14538346 GAGTAGGAGGAGAGAGACACAGG + Intronic
1178413787 21:32387443-32387465 GAGTGGAACCAGAGAGAGGCAGG - Intronic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1178701217 21:34835191-34835213 GAGGAGAGGGAGAGGGAGAGGGG - Intronic
1178777063 21:35561948-35561970 GAGGAGGAGGAGAGAGAGGAAGG + Intronic
1179030093 21:37712674-37712696 GAGGAGAAGGGGAGGAAGGAGGG - Intronic
1179030106 21:37712719-37712741 GAGGAGAAGGGGAGGAAGGAGGG - Intronic
1179195039 21:39156632-39156654 AAGGAGAGGGAGAGGGAGACGGG - Intergenic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179477842 21:41659376-41659398 GCCAGGAAGGAGAGGGAGGCAGG + Intergenic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1179896105 21:44364604-44364626 GGGAGGAAGGAGAGGGATGCAGG + Intronic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1179965613 21:44802928-44802950 GAGTGGAGTGAGAGGGAGGGAGG - Intergenic
1179981990 21:44900478-44900500 GAGAAGAAGGCGTGGGGGGCAGG + Intronic
1179983458 21:44908246-44908268 GAGAAGAAGGGGAGGGCAGCAGG - Intronic
1180018573 21:45104143-45104165 AAGTGGAAGGAGAGGGTAGCAGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180716401 22:17875457-17875479 GAGTCGGAGGAGGGAGAGGCGGG + Intronic
1180798377 22:18619238-18619260 GAGCTGAAGGAGAGGGAGTGAGG + Intergenic
1181223341 22:21376027-21376049 GAGCTGAAGGAGAGGGAGTGAGG - Intergenic
1181255399 22:21559599-21559621 GAGCTGAAGGAGAGGGAGTGAGG + Intronic
1181412983 22:22737988-22738010 GAGAAGGAGGAGATGGAGGATGG + Intronic
1181473274 22:23153665-23153687 AAGTGGAAGGAAAGTGAGGCTGG - Intronic
1181716938 22:24737862-24737884 GTGTAGAAAGAGAAGGGGGCCGG + Intronic
1181817287 22:25448110-25448132 GAGAAGAAGGAAAGCGGGGCCGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181844731 22:25698088-25698110 GGGAGGAAGGAGAGGGAGGGAGG + Intronic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1181998592 22:26902679-26902701 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182438030 22:30343278-30343300 GAGCAGAAATAGAGGGAGGTGGG - Intronic
1182715571 22:32354185-32354207 GTGTAGAGGGGGTGGGAGGCTGG - Intergenic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1183115633 22:35690547-35690569 GAGGAGAAGGGGAGGGAAGAGGG + Intergenic
1183135858 22:35886961-35886983 GACAAGACGGAGAGGGAGGGTGG - Intronic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183258609 22:36779444-36779466 GGGTGGATGGAGAGGGAGTCGGG + Intergenic
1183312265 22:37116835-37116857 GAATAAAAAGAGAGGGGGGCCGG + Intergenic
1183346670 22:37311975-37311997 GGGTGGGAAGAGAGGGAGGCTGG - Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1184032333 22:41902497-41902519 GAGGAGTGGGAGAGGGAGACAGG - Intronic
1184114181 22:42412656-42412678 CGGTAGACAGAGAGGGAGGCAGG + Intronic
1184121186 22:42451644-42451666 GAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1184170908 22:42759246-42759268 GAGTGGAAGAGGAGGAAGGCAGG + Intergenic
1184425915 22:44409256-44409278 GAGTGGACGGCGAGGGAGGTGGG + Intergenic
1184748400 22:46469977-46469999 GAGGAGGAGGGGAGGGAGGGAGG + Intronic
1184882293 22:47316219-47316241 GAGGAGAGGGAGGGGGAGGCTGG - Intergenic
1184959319 22:47917740-47917762 GGGAGGAAGGAGAGGGAGGGAGG - Intergenic
1184959351 22:47917854-47917876 GGGAAGAAGGAGAGGGAGGAGGG - Intergenic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185148000 22:49149741-49149763 GAGAAGCAGGGGAGGGAGGAAGG + Intergenic
1185236060 22:49713725-49713747 GAGGAGCAGGAGAGCGTGGCCGG + Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949165325 3:933670-933692 GAGTTAAAGGAGAGGGAGGATGG + Intergenic
949295327 3:2514937-2514959 GGGTAGAAAGAGAGAGAGGGAGG - Intronic
949319947 3:2798071-2798093 GAGTTGAAAGAGTGGGAGGGTGG - Intronic
949684813 3:6556725-6556747 GAGGAGATAGAAAGGGAGGCAGG - Intergenic
949977295 3:9472723-9472745 GAGATGGAGGAGAGGGAGGTGGG - Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950254888 3:11496406-11496428 GAGTAGAAAGGAAGGGAGGGAGG - Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951080336 3:18444872-18444894 GAAGAGAAGGAGGGGGAGGGAGG + Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952240457 3:31526984-31527006 CATTAGAAGCAGAGGAAGGCCGG - Intergenic
952272309 3:31845210-31845232 GAGCAGGAGAAGATGGAGGCAGG - Intronic
953041347 3:39257478-39257500 GGGGAGAAGAAGAGGGAAGCTGG + Intergenic
953069447 3:39504763-39504785 GAATCAAAGGAGTGGGAGGCAGG + Intronic
953203643 3:40800472-40800494 GAGGAGAAAGAAAGGGAAGCAGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953365425 3:42340467-42340489 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
953405842 3:42659391-42659413 GAGGAGGAGGAGGGGGAGGAGGG + Exonic
953405846 3:42659400-42659422 GAGGGGGAGGAGGGGGAGGCTGG + Exonic
953449660 3:42995728-42995750 GAGAAGAAGGGGAGGGGAGCAGG - Intronic
953625447 3:44567185-44567207 GAAAAGAAAGAGAGGGAGGGAGG + Intronic
953694425 3:45146456-45146478 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
954008541 3:47613811-47613833 GTGAAGAGGGAGAGGAAGGCAGG - Intronic
954081689 3:48215941-48215963 GGGTTGCAGGAGAGGCAGGCTGG - Intergenic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954408112 3:50356728-50356750 GGCTACCAGGAGAGGGAGGCAGG - Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955283459 3:57616354-57616376 GAGGAGGAGGAGGAGGAGGCAGG + Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955699989 3:61672760-61672782 GAGAAGAGGGAGAGGGAGAGAGG + Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956951402 3:74287748-74287770 GGGTGGAAGGAAAGAGAGGCTGG + Intronic
956953035 3:74304296-74304318 TAGGAGAAGGAGAGGGAGAGAGG - Intronic
957282798 3:78175093-78175115 GAGGTGAAGGAGAGGGAAGAAGG - Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957472187 3:80672564-80672586 GAGTAGGAGGAAAGGAAGGAGGG + Intergenic
957595779 3:82263803-82263825 GACTAGAAGGAGGAGGAGGGAGG + Intergenic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958157759 3:89776134-89776156 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
958483014 3:94668391-94668413 GACTAAAATGAGAGCGAGGCAGG - Intergenic
958670934 3:97203007-97203029 GAGGAGTTGGAGAGGTAGGCAGG + Intronic
958777769 3:98506333-98506355 GGGTAAAAGGAGTGGGATGCGGG + Intronic
959112635 3:102140275-102140297 AAGGAGAAAGAGAGGGAGGGAGG - Intronic
959316529 3:104814761-104814783 AAGTAGAGGGAGAGGGTGGGAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959849035 3:111066864-111066886 GTGTAAAAGAAGTGGGAGGCTGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960465845 3:117996495-117996517 GAGGAGGAGAAGAGGGAGGGAGG - Intergenic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961035483 3:123638739-123638761 GAGGAGTAGGAGAGGCAGGAGGG - Intronic
961460290 3:127045673-127045695 GAGGAGAGGGAGAGGGAGGGAGG + Intergenic
961604425 3:128083153-128083175 GAGTTGGAGGGGAGGCAGGCTGG + Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961627967 3:128276656-128276678 GAGTAGAGGGTGAGTAAGGCAGG + Intronic
961781487 3:129323325-129323347 GTGGAGAACGAGAGGGTGGCAGG - Intergenic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962559629 3:136592045-136592067 GAATGGAAGGAAAGGGAGGAAGG + Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962784771 3:138757643-138757665 GAGGAGAGGGAGAGGAAGGAGGG + Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963521069 3:146360574-146360596 GAAAAGAAGGAGAGAGAGGGAGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
963772846 3:149406527-149406549 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
964633002 3:158833041-158833063 GAGGAGGATGAGAGAGAGGCTGG + Intergenic
964860850 3:161199332-161199354 GAGTAGAATGGGAGGCAGGTTGG - Intronic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965347238 3:167566958-167566980 GAGGAGGTGGAAAGGGAGGCAGG + Intronic
965373931 3:167897707-167897729 GAGAGGGAGGGGAGGGAGGCAGG + Intergenic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
965397868 3:168182254-168182276 GAAAAGAAGTAAAGGGAGGCAGG - Intergenic
965585495 3:170314308-170314330 GAGCAGGATGGGAGGGAGGCTGG - Intergenic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
966403494 3:179570775-179570797 CAGTAGCAGGAAAGGTAGGCAGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966592348 3:181696532-181696554 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
966881214 3:184352333-184352355 TAGTAGAGAGGGAGGGAGGCTGG + Intronic
966908491 3:184544536-184544558 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
967000602 3:185330556-185330578 GAGGAGAAGGAGTGGAGGGCTGG + Intronic
967550739 3:190792386-190792408 GAGAAGCAGGAGAGAGAGGAAGG + Intergenic
967945114 3:194797974-194797996 GCGAGGAAGGAGAGGGAAGCAGG - Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968177509 3:196563866-196563888 GACTAAAAGTAGGGGGAGGCTGG - Intronic
968288174 3:197520173-197520195 GAGAGGGAGGAGAGGGAGACGGG + Intronic
968310353 3:197677544-197677566 GAAAAGAAAGAGAGGGGGGCAGG + Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968614304 4:1570534-1570556 GAGCAGTGTGAGAGGGAGGCAGG - Intergenic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
968889292 4:3359184-3359206 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
968957336 4:3726036-3726058 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
968975981 4:3822255-3822277 GACCAGATGGAGAGGGAGACGGG - Intergenic
968978442 4:3834059-3834081 GTGGAGAAGGTGTGGGAGGCAGG - Intergenic
969268147 4:6079404-6079426 AGGTAGAGGGAGATGGAGGCAGG + Intronic
969308846 4:6340528-6340550 GATTGGATGGAGAGGGAGGGAGG - Intronic
969352880 4:6608309-6608331 GTGGGGAAGGAAAGGGAGGCAGG - Intronic
969454772 4:7294839-7294861 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970476533 4:16429449-16429471 GATTCCAAAGAGAGGGAGGCAGG - Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
970943997 4:21668997-21669019 GAGGAGGAGGAGAAGCAGGCAGG - Intronic
970980804 4:22094769-22094791 GATGGGAAGGAGAGAGAGGCGGG - Intergenic
971103255 4:23493599-23493621 GGGTAGAAAGAAAGAGAGGCAGG + Intergenic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
971600789 4:28588745-28588767 GAGTAAACAGAGAGGGAGTCAGG - Intergenic
971630333 4:28984791-28984813 GAGTAGAAGAGGAGGGAGAAAGG - Intergenic
971769824 4:30882098-30882120 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
971960192 4:33476708-33476730 GGGTAGAAGGGTAGGAAGGCAGG - Intergenic
972302426 4:37797510-37797532 GGGTAGCAGGAGAGGAAGGGCGG + Intergenic
972640288 4:40919058-40919080 GGGTACAAGGAAAGGAAGGCTGG + Intronic
972789469 4:42357255-42357277 GAGGAGAGGGGGAGGGAGGGAGG + Intergenic
973899824 4:55457454-55457476 GAGTTGAAGGACAGGGAGACTGG - Intronic
973980411 4:56304077-56304099 GAGAAGAGGCAGAGGGAGGGAGG - Intronic
974389622 4:61249420-61249442 GAGGAGGAGGAGGGTGAGGCAGG - Intronic
974718160 4:65698665-65698687 GAATAGGAGGAGAGGAAGGAAGG - Intergenic
974789081 4:66662755-66662777 GAATAGAATGAGAGGCAGGTTGG - Intergenic
975139089 4:70902294-70902316 GAGGGGAAGGAAAGGGAGGCGGG - Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
977126334 4:93173429-93173451 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
977928595 4:102728704-102728726 GAGTCGCAGGAGGGGCAGGCTGG + Intronic
978209104 4:106113812-106113834 GAGTAGCAGGTGAGGGTTGCAGG - Intronic
978701091 4:111647115-111647137 GAGGAGAAGGAGAGTGTGTCAGG + Intergenic
978811544 4:112854866-112854888 GAGTAGAATGGGAGGGAGGGTGG + Intronic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
978978784 4:114915824-114915846 GAGGAGAAGGAGAGGGGGAGAGG + Intronic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
979740809 4:124148298-124148320 GAAGAGAAAGAGAGGGAGGAAGG - Intergenic
979858565 4:125664968-125664990 GAGTAGAAGCAGTGGGACACTGG - Intergenic
980108778 4:128614751-128614773 GCAAAGAAGGAGAGGGAGGCAGG + Intergenic
980213052 4:129814407-129814429 GAAAAGAAAGAGAGGGAGGGAGG + Intergenic
980309666 4:131109685-131109707 GAGGAGAGGGAGAGAGAGGCTGG + Intergenic
980499820 4:133634781-133634803 GAGTAGCAGGGGTGGAAGGCAGG - Intergenic
980500632 4:133648254-133648276 GAGTAGAGAGAGAGGGAGCAAGG - Intergenic
980931769 4:139189003-139189025 GAGGAGGAGGAGGAGGAGGCTGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981310710 4:143295381-143295403 GAGGTACAGGAGAGGGAGGCTGG - Intergenic
981619344 4:146676399-146676421 GAGAAGGAGGAGAGGGTGGGGGG - Intergenic
982127932 4:152200321-152200343 GACTGGAAGGAAAGTGAGGCTGG - Intergenic
982584087 4:157215241-157215263 GAGTATAATGAGAGGGTGTCTGG + Intronic
983231982 4:165138098-165138120 TTGTAGAAGGAGAGGGAAACAGG + Intronic
983555466 4:169055560-169055582 GAGGTGAAGGAGAGGGAGAAGGG - Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984881445 4:184413185-184413207 GATGGGAAGGAGTGGGAGGCAGG - Intronic
985140939 4:186840376-186840398 GAGGAGAAGGAGGGGGAGGGAGG - Intergenic
985140987 4:186840555-186840577 GAGGAGAAGGAGGGGAAGGGGGG - Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985767581 5:1787922-1787944 GAGCAGGAGGGGAGGGAGGAGGG - Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986360657 5:6975121-6975143 TAGGAGAAAGAGAGGGAGGGAGG + Intergenic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
986495461 5:8337495-8337517 GAAAAGAAGGAGATGGAAGCAGG - Intergenic
986579754 5:9252967-9252989 GAGTAGGGGGATAGTGAGGCTGG - Intronic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
986662887 5:10074860-10074882 GAATGGGAGGTGAGGGAGGCAGG + Intergenic
986943455 5:12985505-12985527 GAGTAGACTGAGAAGGAGGAGGG - Intergenic
987054080 5:14174441-14174463 GGGTAGATAGAGAGGCAGGCGGG - Intronic
987207810 5:15645285-15645307 GAGTAGAATGGGAGGCAGGTTGG - Intronic
987460145 5:18198920-18198942 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
987719605 5:21616886-21616908 GAGTAGGATGGGACGGAGGCAGG + Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
989952916 5:50322244-50322266 GAGGAGAAGGAGAGAGATGCAGG - Intergenic
989983160 5:50666894-50666916 GAGGAGGAGGAGGGGGAGGTCGG - Intronic
989995113 5:50819852-50819874 GAGTAGAAGGAATGTGAGGGTGG + Intronic
990592581 5:57281418-57281440 TAGAAGCAGAAGAGGGAGGCAGG + Intergenic
991073994 5:62514584-62514606 AAGGAGAGGGAGAGGGAGACGGG + Intronic
991083782 5:62629388-62629410 GACTAGTAGGAGAGAGAGGAGGG - Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991137919 5:63205067-63205089 GGGTAGAAGGAGAGCGATGGAGG + Intergenic
991311273 5:65245398-65245420 GGGTAGAAGGGTAGGGAGGATGG - Intronic
991649943 5:68842011-68842033 GAGTGGAGGGAGAGGGAGTGGGG - Intergenic
991923273 5:71679035-71679057 GACTCGAAGCAGAGAGAGGCAGG - Intergenic
992118358 5:73564861-73564883 GAAGAACAGGAGAGGGAGGCGGG + Intronic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
992994458 5:82318661-82318683 GAGGAGGAGGAAAGGGAGGGAGG + Exonic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993425541 5:87759748-87759770 GAGTAGAAGGAGAAGATGGGTGG + Intergenic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
993622556 5:90186160-90186182 GAGGAGGAGGAGAGGGGGGAAGG - Intergenic
993632936 5:90309504-90309526 GAAGGGAAGGAGAGGGAGGGAGG + Intergenic
993900647 5:93582118-93582140 GAGAAGATGGAGAGGGGGGGAGG - Intergenic
994835136 5:104842110-104842132 GTGTAGAAAGAGAGAGAGGGAGG + Intergenic
994850268 5:105046308-105046330 GAGGAGGAGGAGGGGGAGGGAGG - Intergenic
994913685 5:105945639-105945661 GAGGAGGAGGAGAGGAAGGATGG + Intergenic
995803084 5:116020801-116020823 GAGAAGAAGGAGAGGCAGAAAGG + Intronic
996167112 5:120237839-120237861 GAGGAAGAGGAGAGGGAGGGGGG - Intergenic
996341726 5:122445861-122445883 GAGTGGAAGGAGAGAGAGAAGGG - Intronic
996398516 5:123036119-123036141 GAGCAGAACGAGAGGAATGCGGG - Intronic
996404194 5:123090231-123090253 GAGGCGGAGGAGAGAGAGGCGGG - Exonic
996423315 5:123285762-123285784 GGGAAGAGGGAGAGGGAGTCGGG - Intergenic
996629600 5:125611646-125611668 GGGGAGAAAGAGAGGGAGGTAGG + Intergenic
996629607 5:125611668-125611690 GGGGAGAAAGAGAGGGAGGTAGG + Intergenic
997042512 5:130275048-130275070 GAACAGAAGGAGGGGGAGGGGGG - Intergenic
997524512 5:134543823-134543845 AGGTTGAAGGAGAGGGAGGGAGG + Intronic
997715689 5:136040944-136040966 GAGTATAAGGAGAGTGGAGCAGG + Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998352281 5:141509289-141509311 GGGTGGAGGCAGAGGGAGGCTGG + Intronic
998354299 5:141521828-141521850 GATTAAGAGGAGAGAGAGGCTGG - Intronic
998412322 5:141921009-141921031 GGGTAGATGGCGAGGGTGGCTGG - Intergenic
998542884 5:142999448-142999470 GAGAAAGAGGAGAGTGAGGCGGG + Intronic
998785834 5:145707864-145707886 GACAAGAAGGAGAGAGAGCCTGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999030383 5:148284109-148284131 GAGAGGAAGGAAAGGGAGGGAGG - Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999241718 5:150131867-150131889 GAGGAGTGGGAGAGGGAGCCTGG - Intronic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000414099 5:160965348-160965370 GAGCAGGAGGAAAGGGGGGCGGG - Intergenic
1001078732 5:168650932-168650954 GGCTAGAAGGAGAGGGACACAGG + Intergenic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001437903 5:171714917-171714939 GAGGAAAAGGGGAGGGATGCTGG - Intergenic
1001546626 5:172574463-172574485 GAGGGGAAGGAGAGGAAGGATGG - Intergenic
1001718862 5:173840180-173840202 GAGGAGAAGGAGAGGGCAGGAGG + Intergenic
1001919452 5:175588783-175588805 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1002102365 5:176863807-176863829 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1002169336 5:177366681-177366703 GAGGGGAAGGAGGGGGAGGCAGG - Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002206198 5:177564180-177564202 GAGCAAGAGGAGAGGGAGGAAGG - Intergenic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002899508 6:1399259-1399281 GAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1002899548 6:1399463-1399485 GAGGAGGAGGAGAGGGAAGCAGG + Intergenic
1003251917 6:4436223-4436245 GAGTTGAAAGAGAGGTAGGTGGG + Intergenic
1003435926 6:6088021-6088043 GAGAAGAAAGAGAGGGAGAAGGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003610168 6:7606178-7606200 GAGAAGAAGGAAAGAGAGGTGGG + Exonic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1004121777 6:12830464-12830486 GACTAGAAGGAGAGAGGGGGAGG + Intronic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004131201 6:12921620-12921642 GGGAGGAAGGAGAGGGAGGGAGG + Intronic
1004233321 6:13852025-13852047 GAGGAGAGGGAGAGGGAGGGAGG - Intergenic
1004280866 6:14278520-14278542 GAGGAGAGGGAGAGGAAGGTGGG + Intergenic
1004375802 6:15089832-15089854 AAGCAGAAGGACAGGGTGGCAGG + Intergenic
1004442177 6:15663849-15663871 GAATTGACGGAGAGGGAGGAAGG - Intergenic
1004627838 6:17393657-17393679 GAGGAGAAGGGGAGGGCCGCGGG + Exonic
1005068796 6:21845097-21845119 AAGTGGAAGGAGGGGGAGACTGG - Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005498670 6:26411418-26411440 GAGCTGTAGAAGAGGGAGGCTGG + Intronic
1005627088 6:27672887-27672909 GAGTACAAAGTGAGAGAGGCAGG - Intergenic
1005837003 6:29717832-29717854 GGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005838014 6:29722682-29722704 GAGAAGAAGAGGAGGGGGGCGGG + Intergenic
1005850767 6:29819055-29819077 GAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1005857648 6:29874780-29874802 GAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1005871398 6:29976525-29976547 GAGCAGAAGGAGCTGGAGGTAGG - Intergenic
1006094680 6:31648623-31648645 GAGAAAAGGGAGAGGGAGGGTGG + Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006295137 6:33166895-33166917 GAGGACATGGAGAGGGAGCCGGG + Intronic
1006304162 6:33208761-33208783 GAGGAGAAGGCGAAGAAGGCTGG - Exonic
1006525399 6:34600253-34600275 GAGTAGAAGAAGATGAAGTCAGG - Intronic
1006744136 6:36329887-36329909 GAGGAGGAGGAGAGGAAGGAAGG + Intronic
1006932852 6:37697929-37697951 GAGGAGGAAGAGAGGGAGGGAGG - Exonic
1007074985 6:39060625-39060647 GGGCAGAGGGAGAGAGAGGCTGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007517987 6:42428837-42428859 GAAGGGAGGGAGAGGGAGGCAGG - Intronic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1007692108 6:43709129-43709151 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007877068 6:45116210-45116232 GAGAAGAAGGAGAGGAAGGGAGG - Intronic
1007998884 6:46338018-46338040 GATTAGGAGTAGAGGGATGCTGG + Intronic
1008047990 6:46871422-46871444 GAGTAGTAGGGGAGTGAGCCAGG + Intronic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1009295630 6:61942958-61942980 GAGGAGAGAGAGAGGGAGGGAGG + Intronic
1009952470 6:70413396-70413418 GAGGAGGAGGTGAGAGAGGCCGG + Exonic
1010083327 6:71887558-71887580 GAGTAGAAACAAGGGGAGGCAGG + Intronic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010467661 6:76188132-76188154 GAGTAAAATGACAGAGAGGCTGG + Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011051406 6:83154729-83154751 GAGTAGAAAGAGGGGGTGGGGGG - Intronic
1011083317 6:83512393-83512415 GAGGAGACGGAGAGGGAGGGCGG - Intergenic
1011742611 6:90377637-90377659 GAGGAGGAGGGGAGGGAGGGAGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012330010 6:97973617-97973639 AAGTAGAAGTTGAGGGAGGTTGG + Intergenic
1012399922 6:98834651-98834673 GAGGAGAAAGAGAGCGAGGGCGG + Exonic
1012412220 6:98971451-98971473 TAGTGGAAGGAGAGGCAGTCAGG + Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1013309574 6:108880721-108880743 GAGAAGAGGGAGAGGGAAGGGGG - Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1015591454 6:134826686-134826708 GAAAAGAAGGAGAGGGAAGGGGG + Intergenic
1015645251 6:135380035-135380057 AAGAAGAAAGAGAGGGAGGGAGG - Intronic
1015727054 6:136309841-136309863 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016221601 6:141677909-141677931 GAGGAGACGGAGAGAGAGACAGG - Intergenic
1016245912 6:141980599-141980621 GAAGAGAAGGAAAGGGAGGATGG + Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016724630 6:147348338-147348360 GAGGTGAGGGAGAGGGAGGGAGG - Intronic
1017164207 6:151391740-151391762 GAGCAGCAGGAGGCGGAGGCGGG - Intergenic
1017437991 6:154435777-154435799 GAATAGGAGGAGAGGCAGGGGGG - Intronic
1017473671 6:154766248-154766270 GAGGAGAGGGAAGGGGAGGCAGG + Intronic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1017770057 6:157638087-157638109 GAGGAGAGGGAGGTGGAGGCAGG + Intronic
1017919336 6:158857649-158857671 AAGTACATGGTGAGGGAGGCAGG - Intergenic
1018322570 6:162627539-162627561 GAGTTGGAGGCGAGGGAGACTGG + Intronic
1018691732 6:166350882-166350904 GAGGAGAGGGAGAGAGAGACAGG + Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018931586 6:168243601-168243623 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931608 6:168243717-168243739 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019516393 7:1442068-1442090 GATGAGACGGAGAGGAAGGCGGG + Intronic
1019531680 7:1506548-1506570 GAGAAGAAGGAAGGGGAGGAGGG - Intergenic
1019531747 7:1506688-1506710 GAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1019551827 7:1606906-1606928 GGGTAGGAGGAGGGGGAGGGAGG - Intergenic
1019705659 7:2496051-2496073 GAGTTGAAGGCGGGTGAGGCTGG - Intergenic
1019805054 7:3117575-3117597 GAGAAAGAGGAGAGGGAGGGAGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1019965276 7:4493819-4493841 GAGGCGAAGGAGAAGCAGGCAGG + Intergenic
1019972114 7:4549634-4549656 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1020011330 7:4807462-4807484 GGGGAGAAGGAGAGGGAAGAAGG - Intronic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1020011392 7:4807668-4807690 GGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020011500 7:4808039-4808061 GGAGAGAAGGAGAGGGAGGAAGG - Intronic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020086408 7:5313035-5313057 GAGGAGGAGGAGGAGGAGGCCGG + Exonic
1020249101 7:6452939-6452961 AAGTAGAAGGAATGAGAGGCAGG + Intronic
1020274121 7:6614902-6614924 GAGGAGAGGGTGAGGGAGGTGGG + Intergenic
1020463769 7:8453140-8453162 AAGTAGAAGGAGAGGGGGAAAGG + Intronic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1021036006 7:15799868-15799890 GAGTAGACTGAGAGGGAGCAAGG - Intergenic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1021425147 7:20491086-20491108 GAGCAGAAGAAGAGAGAGACGGG - Intergenic
1021427810 7:20522628-20522650 AAAGAGGAGGAGAGGGAGGCTGG + Intergenic
1021493309 7:21244625-21244647 GAGTAGGGTGAGAGGGAGGAAGG - Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022278726 7:28883276-28883298 GAGAAGAAAGAAAGGGAGGGAGG - Intergenic
1022479854 7:30735757-30735779 GAGTAGAGTGAGAGGGAAGAAGG + Intronic
1022748164 7:33193996-33194018 GAGTAGAAGAAGTGGAAGACAGG - Intronic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023119764 7:36897564-36897586 GAGGAGTAGGAGAAGGAAGCTGG + Intronic
1023172422 7:37402580-37402602 GAGTAGAGGGAGAGAGAGTCTGG + Intronic
1023278995 7:38550681-38550703 GAGTGGTGGGAGAGGGAGGAGGG - Intronic
1023556624 7:41430118-41430140 GAGAAACAGGAGAGGAAGGCTGG - Intergenic
1023615168 7:42012378-42012400 GAGAAGAAGAAAAGGGAGGGGGG - Intronic
1023737355 7:43246998-43247020 GAGTGGAAGGAGTTGGTGGCTGG + Intronic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024436793 7:49365884-49365906 GAGAAGAATGAGAGTGAGGGCGG - Intergenic
1024551469 7:50566050-50566072 GAGCAGAGTGAGAGTGAGGCTGG + Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025200580 7:56958926-56958948 GGGCAGAAAGAGAGGGAGACAGG + Intergenic
1025201905 7:56967383-56967405 GAGCAGAGGGGGCGGGAGGCAGG - Intergenic
1025212821 7:57030691-57030713 GAGGAGGACGAGAGGGCGGCTGG - Intergenic
1025280454 7:57623227-57623249 GAGCAGAGGGAGTGGGTGGCTGG - Intergenic
1025304277 7:57842280-57842302 GAGCAGAGGGAGTGGGTGGCTGG + Intergenic
1025573180 7:62600678-62600700 GAGGAGAGGGAGAGGGAGAGGGG + Intergenic
1025659132 7:63546133-63546155 GAGGAGGACGAGAGGGCGGCTGG + Intergenic
1025664037 7:63572796-63572818 GAGGAGGAGGAGGAGGAGGCCGG + Intergenic
1025670041 7:63609545-63609567 GAGCAGAGGGGGCGGGAGGCAGG + Intergenic
1025671364 7:63618006-63618028 GGGCAGAAAGAGAGGGAGACAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1026142532 7:67718487-67718509 GAGTAGAATGGGAGGCAGGTTGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026477160 7:70746708-70746730 AAGGAGAGGGAGAGGGGGGCAGG + Intronic
1026591724 7:71702128-71702150 GAGTAGAGAGAGAGGGAGGAGGG + Intronic
1026670070 7:72382605-72382627 GAGGAGAAAGGGAGGGAGGTGGG - Intronic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1026890886 7:73981542-73981564 GAAAGGAAGGAGAGGGAGGGAGG + Intergenic
1026941562 7:74290305-74290327 GGGTAGGAGGAGATTGAGGCGGG + Intronic
1027268297 7:76505749-76505771 GGGGAGGAGGAGAGAGAGGCAGG - Exonic
1027386353 7:77662993-77663015 GGGAAGAAGGAGAGAGAGGAAGG + Intergenic
1027397180 7:77767849-77767871 GAATGAAAGGAGAGGGAGGGGGG - Intronic
1027545225 7:79519189-79519211 GGGAAGAAGGAGAGGGAAGAGGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027753828 7:82185521-82185543 GAGGAGGAGGAGGGGGAGGAAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028189955 7:87835707-87835729 GCGGGGAAGGAGAGGGAGGCGGG + Exonic
1028482094 7:91318050-91318072 GACTAAAAGGAGAGAGAGGGAGG + Intergenic
1028728132 7:94112675-94112697 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1029199312 7:98827979-98828001 GGAGAGGAGGAGAGGGAGGCAGG - Intergenic
1029298309 7:99558849-99558871 GAGTAGAAGGAGGCGGCGTCCGG + Exonic
1029412958 7:100427150-100427172 GAGAAGAGAGAGAGGGAGGGAGG - Intronic
1029424371 7:100486990-100487012 GAGTGGCAGGAGAGGGAGCGTGG - Exonic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029675958 7:102069094-102069116 GAGGAGGAGGAGAGGGCGGCTGG - Intronic
1029869942 7:103680198-103680220 GGTGAGAAGGAGAGGGAGGAGGG + Intronic
1029983694 7:104902428-104902450 GAGGAGGAGGAGGGGGAGGAGGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1031227220 7:119054869-119054891 GAATAGAATGGGAGGCAGGCTGG + Intergenic
1031312295 7:120213484-120213506 GGGTGGAAGGAGGGGGAGGGTGG + Intergenic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031453513 7:121951663-121951685 GAGGAGATGAAGAGGCAGGCTGG - Intronic
1031556378 7:123181548-123181570 AGTTAGAAGGAGAGGAAGGCAGG - Intronic
1031681599 7:124681415-124681437 GAGGAGGTGGAAAGGGAGGCAGG - Intergenic
1031936816 7:127743509-127743531 GAAGAGAAGGAGAGAGAGGGTGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032797406 7:135288909-135288931 GACAGGGAGGAGAGGGAGGCAGG + Intergenic
1032908109 7:136396094-136396116 GAGGAGGAGGAAAGGAAGGCAGG + Intergenic
1032917849 7:136511661-136511683 GAGGAGCTGGAGAGGGAGGCTGG + Intergenic
1032948715 7:136882437-136882459 GAGAAGAAGGAGGGGGAAGGAGG - Intronic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033185507 7:139224420-139224442 GAAGAGAAGGACAGGGAGGGAGG + Intergenic
1033241595 7:139684243-139684265 GAGAAGAAGGAGAGAGATGGGGG - Intronic
1033349714 7:140552356-140552378 AAGGAGAGGGAGAGGGAGGGAGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033610832 7:142961889-142961911 GAGAAGGAGGAGAGAGAAGCTGG + Intronic
1033830850 7:145250595-145250617 GGGAAGAAGGAAAGGGAAGCAGG - Intergenic
1034420245 7:150986776-150986798 GGGTGGCAGGAGAGGGAGACAGG + Intergenic
1034606811 7:152323782-152323804 GAGGGGAAGGGAAGGGAGGCAGG + Intronic
1034672082 7:152866666-152866688 GAGAAAAAGGGAAGGGAGGCCGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034936289 7:155202922-155202944 GAGGAGCAGGAGAGAGAGGAGGG + Intergenic
1035209827 7:157319541-157319563 GACTGGAAGGAAAGGGAGCCAGG + Intergenic
1035280779 7:157776696-157776718 GAGGCGGAGGAGAGGGAGGCAGG - Intronic
1035471728 7:159114277-159114299 GAGGAGAAGGGGAGGCAGGCAGG + Intronic
1035603989 8:917015-917037 GAGAAGAAGGTGTGAGAGGCAGG + Intergenic
1036024666 8:4892057-4892079 CAGTAGAAGGTGCGGGAGGTAGG + Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036143032 8:6225704-6225726 GTGGGGAAGGAGAGGGAGGGAGG - Intergenic
1036213506 8:6861514-6861536 GAATAGAATGAGAGGCAGGTTGG - Intergenic
1036448740 8:8846324-8846346 GAGGAGTAGGAGGGGGAGGAGGG + Intronic
1036453955 8:8892517-8892539 GAGAGGCAGGAGAGGGAGTCAGG + Exonic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037356606 8:18026685-18026707 GAGGAGGAGGAGAGAGAGGTAGG - Intronic
1037497022 8:19450148-19450170 GAGGAGGAGGAGAGGGAGAAGGG + Intronic
1037542461 8:19885586-19885608 GAAAAGAAGGAAAGGGAGGAGGG - Intergenic
1037608014 8:20453771-20453793 GAAGAGGAGGAGAAGGAGGCTGG + Intergenic
1037683415 8:21117499-21117521 GAGGAGAAGGAGTGAGAGGTGGG - Intergenic
1037747832 8:21661055-21661077 GAGCAGAAGGAGAGGCCGGTAGG - Intergenic
1037760484 8:21738452-21738474 GAGTTGGAGGAGAGCAAGGCTGG - Intronic
1038035251 8:23681945-23681967 GAGAGGCGGGAGAGGGAGGCAGG + Intronic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038223614 8:25634008-25634030 GAATGGTAGGAGAGAGAGGCGGG - Intergenic
1038339530 8:26673896-26673918 GAGGAGGAGGGGAGGGAGGAAGG - Intergenic
1038426162 8:27465261-27465283 AATTAGAAGGGGAGGGAGGATGG - Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038652756 8:29420692-29420714 GAGTGGGAGAAGAGGGAGACAGG + Intergenic
1038721335 8:30038583-30038605 GAACAGAGGGAGAGGGAGGGAGG + Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039474887 8:37834389-37834411 GAGTAGAAGGGATGGGAGGAAGG + Intronic
1039476817 8:37843123-37843145 GAGTAGAGGGAGAGGGCAGGTGG + Exonic
1039498275 8:37997570-37997592 GAAAAGAAGGAGAGAGAGGGAGG - Intergenic
1039552334 8:38452020-38452042 GAGGGGAAGGAGAGGGAGAGGGG + Intronic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039854273 8:41398893-41398915 GAGTAGAGGGAGATGGTGGATGG + Intergenic
1040435289 8:47384702-47384724 GAGGAGGAGGAGAGGACGGCAGG - Intronic
1040842992 8:51804320-51804342 GAGTAGAACGGGAGGAAGGTTGG + Intronic
1041098130 8:54369853-54369875 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041371535 8:57165834-57165856 GAATAGAAGGAGAGGCAGGTTGG + Intergenic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041492634 8:58451826-58451848 GAATAGAATGAATGGGAGGCAGG - Intergenic
1041602146 8:59731749-59731771 GGGGAGAAGAAGAGGGAGGGTGG + Intergenic
1041639098 8:60177679-60177701 GACTACAAGAAGGGGGAGGCAGG - Intergenic
1041746153 8:61211331-61211353 GAGAAGAAGGAGGGAGAGGAAGG - Intronic
1042064001 8:64853824-64853846 GCGTAGAAGAGGAGGGAGTCGGG + Intergenic
1042104976 8:65316440-65316462 GATGAGAAGGAAAGGAAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042184378 8:66122217-66122239 GAATAGAATGAGAGGCAGGTTGG - Intergenic
1042766445 8:72327201-72327223 GATTAGAAGGAGAGGGACACTGG - Intergenic
1042785041 8:72537195-72537217 GAGGAGGCGGAGCGGGAGGCTGG + Intergenic
1042905258 8:73766048-73766070 GAGGAAAAGGGGAGGGAGGGAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043384370 8:79733366-79733388 GAGAAGTAGAAGAGGGAGCCAGG + Intergenic
1043746939 8:83886196-83886218 AAGGAGATGGAAAGGGAGGCAGG + Intergenic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044526884 8:93262278-93262300 GAGCAGAAGGAGAGGGGGAGAGG + Intergenic
1044619735 8:94177121-94177143 AAGGAGAAAGAGAGGGAGACGGG + Intronic
1045237036 8:100361261-100361283 GTGGTGATGGAGAGGGAGGCAGG + Intronic
1045294157 8:100859570-100859592 GAGTACGAGGAGAGGCAGGTGGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046571755 8:115974935-115974957 GAGAAGAAGGAGAGAGATGGAGG + Intergenic
1046983569 8:120362797-120362819 GAGTAGGAGGAGATGGAGGGAGG + Intronic
1047711117 8:127553440-127553462 CAGTAGCAAGAGAGAGAGGCAGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048316977 8:133369839-133369861 GAGCAGAAGGAGAGGAAGAGAGG + Intergenic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048416348 8:134231617-134231639 GAGTTGAGAGAGAGGGGGGCGGG - Intergenic
1048516580 8:135116818-135116840 GAGGAGGAGGAGAGGGGGGAGGG - Intergenic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049075918 8:140396072-140396094 GAGTGGAGGGAGAGGAAGGGAGG - Intronic
1049122057 8:140747735-140747757 AAGTAGGAGGAGGGGGAGGAAGG + Intronic
1049356699 8:142192719-142192741 GAGAAGAGTGAGAGGGAGGGAGG + Intergenic
1049391333 8:142373139-142373161 GAGAAGAAAGAGAGGAAGGGAGG + Intronic
1049748817 8:144274053-144274075 GAGGAGAAGGGGAGGTAGGTGGG + Intronic
1051170579 9:14315397-14315419 GAGGAGGAGGAGAGCGAAGCCGG - Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051256992 9:15224093-15224115 GAATAGAAGGAGTGGGAGAAGGG - Intronic
1051705655 9:19877271-19877293 GAGGAAAAGGAGAGACAGGCTGG + Intergenic
1051806376 9:20997178-20997200 GATGGGAAGGAGAGGGAAGCTGG - Intergenic
1052262757 9:26537041-26537063 GAGTAGCCGGAGAGAGAGGAAGG + Intergenic
1052434415 9:28407988-28408010 GAGTACAGCGAGAGGGAGGGAGG + Intronic
1052475915 9:28958730-28958752 GAGAAGAAGGGAAGGGAGGGGGG + Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053105622 9:35405593-35405615 GAGTAGCAGGAGAGGTATTCTGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053221410 9:36316131-36316153 GAGGAGAAGGAGGGGGAAGAGGG + Intergenic
1053632540 9:39958773-39958795 GAGTGAAAGGGAAGGGAGGCAGG - Intergenic
1054211348 9:62291924-62291946 GAGTGAAAGGGAAGGGAGGCAGG + Intergenic
1054922529 9:70556348-70556370 GAGTAAAAGGTGGGGGAGGCTGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1055084964 9:72304643-72304665 GATGAGGAGGAGAGGAAGGCAGG - Intergenic
1055084992 9:72304926-72304948 GAAAAGGAAGAGAGGGAGGCTGG - Intergenic
1055150677 9:72995258-72995280 GAGGAGAAGGAGAGAGATGGGGG - Intronic
1055432639 9:76259433-76259455 GTGTAGACAGAGAGGGAGGGAGG - Intronic
1055580743 9:77703877-77703899 GAGACGAGGGAGAGGGAGACGGG + Intergenic
1055618061 9:78093826-78093848 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1055995182 9:82149572-82149594 GAGGAGAAGGAGAGGAAGCATGG + Intergenic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057274703 9:93670178-93670200 GAGCAGAGGGAGAGGACGGCAGG + Intronic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057712075 9:97454838-97454860 GAATTGAAGGAGATGGAGACAGG + Intronic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1057774693 9:97997805-97997827 GAGTAGAAGGAATTGGAGCCTGG - Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1057962955 9:99474402-99474424 GGGGAGGAGGAGAGAGAGGCTGG - Intergenic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058916021 9:109566487-109566509 GAGGTGAAGGGGAGGAAGGCAGG - Intergenic
1058957011 9:109958688-109958710 GAGAGGAAGGAGAGGAAGGAAGG + Intronic
1059114259 9:111586684-111586706 GAGTAGTAGGGGTGGAAGGCAGG - Intronic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1059150254 9:111943062-111943084 GAGCAGAAGAAGGGTGAGGCTGG - Intergenic
1059352882 9:113678059-113678081 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1059456704 9:114404241-114404263 GAGTAGGTGGAGAGGGTGGCAGG - Intronic
1059611371 9:115900681-115900703 GAGGAGGAGGAGAGGAAGGAGGG - Intergenic
1059648271 9:116288478-116288500 GAGAAGGAAGAAAGGGAGGCAGG - Intronic
1059942773 9:119374012-119374034 GAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1060237256 9:121873611-121873633 GAGGAGGAGGAGGAGGAGGCGGG - Intronic
1061216524 9:129224891-129224913 GAGTCGAAGGAGAGGAGGACGGG - Intergenic
1061385632 9:130287806-130287828 AAGAGGAAGGAGAGAGAGGCAGG + Intronic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1061783235 9:133008001-133008023 GAGGAGAAGGAAAGGGAGATGGG - Intergenic
1061783243 9:133008027-133008049 GAGGAGAAGGAAAGGGAGATAGG - Intergenic
1061859557 9:133460860-133460882 GCGGAGAAGGGGAGGAAGGCCGG - Intronic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062348644 9:136127873-136127895 GAGGAGGAGGAGGAGGAGGCTGG + Intergenic
1062386174 9:136312386-136312408 GCCCAGCAGGAGAGGGAGGCCGG - Intergenic
1062514140 9:136923839-136923861 GTGTAGAAGGCTGGGGAGGCAGG - Exonic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062675182 9:137738863-137738885 GAGTAGAAGGGGCTGGAGTCTGG + Intronic
1062697933 9:137884901-137884923 GAGAAACAGAAGAGGGAGGCGGG - Intronic
1203631825 Un_KI270750v1:78011-78033 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1185485846 X:481525-481547 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485869 X:481597-481619 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485886 X:481652-481674 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485914 X:481752-481774 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485926 X:481786-481808 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485932 X:481803-481825 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485956 X:481894-481916 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485977 X:481962-481984 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185662050 X:1735647-1735669 GAGGAGGAGGAGGGGGAGGGGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185957695 X:4510005-4510027 TATTAGAGGGAGAGGGAGGGGGG - Intergenic
1186031930 X:5377639-5377661 GAGTGGAGGGAGAGGGAGAAAGG + Intergenic
1186064106 X:5742956-5742978 GAGGAGAAGGAGGGGAAGGAGGG + Intergenic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186690929 X:11974780-11974802 GAGTAGAAAGAGAGGGTCACTGG + Intergenic
1186813449 X:13212490-13212512 GAGTAGAAGGACAGGAAGGAAGG + Intergenic
1187180185 X:16936574-16936596 TGGTAGTAGGAGAGGGAGGTAGG + Intergenic
1187447630 X:19373014-19373036 GAGCAGAAGGAGGGGGAGGCGGG + Intronic
1187830249 X:23374013-23374035 GAGTAGAAGAAGTGGGAAGGGGG + Intronic
1188666702 X:32831581-32831603 GAGCAGAAGGAGAGAGAGAAGGG + Intronic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189110821 X:38286846-38286868 GAGCAAAAGGAGAGGGAGCAGGG - Exonic
1190047538 X:47124738-47124760 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190057415 X:47189793-47189815 AAGGAGAGGGAGAGGGAGGGTGG - Intergenic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190322022 X:49185110-49185132 GCGTAGATGGAGAGGGAACCGGG - Intronic
1190329270 X:49225857-49225879 GGGTAGAAGGAATAGGAGGCTGG + Intronic
1190579808 X:51881347-51881369 GAAGAGCATGAGAGGGAGGCAGG - Intronic
1190602793 X:52109410-52109432 GAATACTAGGACAGGGAGGCAGG - Intergenic
1190608303 X:52167977-52167999 GAGCAGATGGAAGGGGAGGCAGG - Intergenic
1190723652 X:53172102-53172124 GAGAGGAAGAAGAGGGAGGGAGG + Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192190060 X:68985571-68985593 GAGGAGAAGGACAGGGGGGAAGG + Intergenic
1192208683 X:69112878-69112900 GAGCAGAGGGTGGGGGAGGCCGG + Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192709022 X:73560602-73560624 GAGTAGATGGAGAAGAAAGCAGG - Intergenic
1192847999 X:74925493-74925515 GAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1193401531 X:81050620-81050642 GAATAGAAGAAGAGGGAGAAAGG - Intergenic
1194167863 X:90542798-90542820 GAGAAGAAGGAGAGAGATGAGGG + Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194795505 X:98207360-98207382 GAGGAGATGGAAGGGGAGGCAGG - Intergenic
1195597664 X:106711165-106711187 GAGTAGGTGGGGAGAGAGGCTGG - Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195697295 X:107676597-107676619 GAGGAGGTGGAGAGGCAGGCAGG - Intergenic
1195702049 X:107712929-107712951 GCGGAGCAGGAGAGGGAGGAAGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196109528 X:111930999-111931021 GAGGAGGAGGACAGGGAGGAAGG + Intronic
1196599226 X:117583034-117583056 GAGCAGAAGGAGAGGGGAGGAGG - Intergenic
1196601297 X:117604452-117604474 GAGCAGAAAGAGAGAGAGGGGGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1198204350 X:134452158-134452180 GAGAAGAGGGGGAGGGAGGGAGG + Intergenic
1198507245 X:137312909-137312931 GGGTAGAAGGAAAGAGAGGGTGG - Intergenic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1198970891 X:142278226-142278248 GTAGAGAAGGAGAGGGAGCCAGG - Intergenic
1199249582 X:145644626-145644648 GAGGGGAAGGAGAGAGAGGGAGG + Intergenic
1199590749 X:149466286-149466308 GAGGAGGTGGAAAGGGAGGCAGG - Intergenic
1199598865 X:149528683-149528705 GGGTAGAGAGAGAGGGAGGGAGG - Intronic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1199650776 X:149944771-149944793 GAGGAGAAGGAGAGGAGGGGGGG + Intergenic
1200142319 X:153908328-153908350 GAGGAGCAGGAGCGGGAGCCAGG - Intronic
1200306005 X:155026748-155026770 GAGTAGAGGGAGAGCGAGGGAGG + Exonic
1200338024 X:155372697-155372719 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1200348445 X:155467997-155468019 GAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1200514120 Y:4120588-4120610 GAGAAGAAGGAGAGAGATGAGGG + Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1201016161 Y:9604208-9604230 GGGTAGAAGCAGAGGGTTGCGGG + Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201319345 Y:12680940-12680962 GAATAGAATGGGAGGCAGGCTGG - Intergenic
1201741072 Y:17325299-17325321 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1201741124 Y:17325531-17325553 GAATAGAGGGAGAGGGAGGGAGG + Intergenic