ID: 1004122661

View in Genome Browser
Species Human (GRCh38)
Location 6:12839581-12839603
Sequence TAGGGGTACCAGGATTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004122655_1004122661 -8 Left 1004122655 6:12839566-12839588 CCCACTGACCCCTCATAGGGGTA 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1004122661 6:12839581-12839603 TAGGGGTACCAGGATTATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 75
1004122650_1004122661 5 Left 1004122650 6:12839553-12839575 CCTTCTGCCTGGTCCCACTGACC 0: 1
1: 0
2: 2
3: 33
4: 343
Right 1004122661 6:12839581-12839603 TAGGGGTACCAGGATTATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 75
1004122651_1004122661 -2 Left 1004122651 6:12839560-12839582 CCTGGTCCCACTGACCCCTCATA 0: 1
1: 0
2: 1
3: 12
4: 181
Right 1004122661 6:12839581-12839603 TAGGGGTACCAGGATTATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 75
1004122656_1004122661 -9 Left 1004122656 6:12839567-12839589 CCACTGACCCCTCATAGGGGTAC 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1004122661 6:12839581-12839603 TAGGGGTACCAGGATTATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 75
1004122648_1004122661 20 Left 1004122648 6:12839538-12839560 CCTGTGGGCTGGGTTCCTTCTGC 0: 1
1: 0
2: 1
3: 23
4: 230
Right 1004122661 6:12839581-12839603 TAGGGGTACCAGGATTATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004122661 Original CRISPR TAGGGGTACCAGGATTATCT TGG Intronic
912111357 1:106346595-106346617 TAGGAGCTCCAGGTTTATCTCGG - Intergenic
914687628 1:149995223-149995245 TTGGGGATCCAGGAGTATCTGGG - Intronic
918609699 1:186474484-186474506 TAGGGATACCCAGATTGTCTAGG + Intergenic
922106769 1:222518867-222518889 GCGGGGTACCAGGATTAGGTTGG - Intergenic
924115382 1:240740410-240740432 TAGGGAAACTAGCATTATCTAGG - Intergenic
1066727417 10:38408470-38408492 GCGGGGTACCAGGATTAGGTTGG + Intergenic
1067427210 10:46219471-46219493 CAGGGGAACCAGGATTCTCATGG - Intergenic
1071314772 10:84384281-84384303 TTTGGGTACCAGGATGATATTGG - Intronic
1080420980 11:32110222-32110244 TAGGGCAACCAGGATCGTCTTGG + Intergenic
1084731035 11:71073808-71073830 TGGGGGTACCAGAACTATCCTGG + Intronic
1085351062 11:75798101-75798123 TGGGTGTACCAGAATTACCTGGG - Intronic
1086962109 11:92988618-92988640 TAGGACTTCCAGTATTATCTTGG - Intergenic
1090944578 11:131418585-131418607 TAGGGGCACCATGATTAAATTGG + Intronic
1104745933 12:131210551-131210573 TATGGTTTCCAGGATCATCTGGG - Intergenic
1105928332 13:25028698-25028720 TAGGTGTATCAGGAATATCAGGG + Intergenic
1109012834 13:56973119-56973141 TAGGAGTTCCAAGTTTATCTTGG + Intergenic
1109200322 13:59423424-59423446 GACGGGTACCAGGATCAGCTTGG + Intergenic
1110256960 13:73443471-73443493 TAGGAGCTCCAGGTTTATCTTGG + Intergenic
1110347565 13:74465787-74465809 TAGTGGTACTGGAATTATCTAGG + Intergenic
1125323818 15:38515841-38515863 CAGGGGTATGAGGATTATCAGGG + Intronic
1131528928 15:93175910-93175932 TAGGGGTGCCAGGAGTACCTTGG + Intergenic
1139047540 16:63080970-63080992 TAGAGGTGCCAGGATTTGCTGGG + Intergenic
1139193189 16:64888569-64888591 TAGGTGTACCAGGGTTCTCCTGG - Intergenic
1141663826 16:85455581-85455603 TTGGGGGACCCCGATTATCTGGG + Intergenic
1158146758 18:54322986-54323008 TAGGGCCACCAGGATAATCCAGG + Intergenic
1160621545 18:80174565-80174587 CAGGGGTAACAGCATTATCCAGG + Intronic
1164732552 19:30517336-30517358 AAGGGCTCCCAGGATCATCTCGG + Intronic
931356303 2:61539704-61539726 TAGATGTACCAGAATTATTTTGG + Intergenic
934130944 2:88948097-88948119 TTGGTGTATCAGGATTATTTAGG + Intergenic
934962569 2:98690022-98690044 TAGGGTTAGCAGGCTTTTCTTGG - Intronic
938745202 2:134271304-134271326 TAGGGTGACCACGATTTTCTGGG + Intronic
941207940 2:162597976-162597998 TAGGGGTAGAAAGATTCTCTGGG - Intronic
941811789 2:169762612-169762634 TAGGGCCACCAGGATAATCTAGG + Intronic
942541794 2:177022488-177022510 GAGGGGTTTCAGAATTATCTGGG + Intergenic
942688642 2:178561648-178561670 TAGGAGTACCAGGAGGACCTGGG + Exonic
1173327223 20:42045064-42045086 TAGGTCTACCTGGATTATCCAGG + Intergenic
1173988668 20:47282774-47282796 TAGCTGTACCATTATTATCTGGG + Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
958552813 3:95638223-95638245 TAGGTTTACGAGGGTTATCTGGG - Intergenic
959010840 3:101074201-101074223 TAGGACTACCTGGATTATCCGGG + Intergenic
961823569 3:129587386-129587408 GAGGAAGACCAGGATTATCTGGG + Intronic
963724373 3:148903490-148903512 TAGGAGTATCAGCATTACCTGGG - Intergenic
969177465 4:5409657-5409679 TGGGGGCACCAGAATTAGCTGGG + Intronic
969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG + Intergenic
970124407 4:12792957-12792979 TTGGTCTACCAGGACTATCTTGG - Intergenic
971807650 4:31380900-31380922 TAGGGATACTAGGATAATGTGGG + Intergenic
974943052 4:68491202-68491224 TAGGGAGAGCAGGATTTTCTTGG + Intronic
979254397 4:118596761-118596783 GCGGGGTACCAGGATTAGGTTGG + Intergenic
979334567 4:119449270-119449292 CAGGGGTACCAGGATTAGGTTGG - Intergenic
979386383 4:120069822-120069844 TGGAGGTACCAGGGTTTTCTAGG + Intergenic
985722825 5:1499612-1499634 TAGGGGCAACAGGATCATCACGG - Intronic
986648461 5:9941144-9941166 GAGGGGTACCAGGGATATATGGG - Intergenic
987261679 5:16210773-16210795 TAAGGGTCCAAGGATTCTCTTGG + Intergenic
987513845 5:18880290-18880312 TAGAGGAAGCAGGATTATTTTGG - Intergenic
988439428 5:31215347-31215369 TAGGGGTACCATCAATATTTAGG + Intronic
990240845 5:53815222-53815244 TAAAGGTATCAGAATTATCTGGG + Intergenic
997907197 5:137830041-137830063 TAGGGGTAGTAGGGGTATCTTGG - Intergenic
999711502 5:154322456-154322478 TTGAGGAGCCAGGATTATCTAGG - Intronic
1004122661 6:12839581-12839603 TAGGGGTACCAGGATTATCTTGG + Intronic
1005652227 6:27894897-27894919 GAGGTGTGCCAGGATTAGCTGGG + Intergenic
1008906381 6:56681803-56681825 TAAGGAGACCAGGATTCTCTTGG + Intronic
1024069490 7:45774409-45774431 CAGGGGTACCAGGATTAGGTTGG + Intergenic
1026011065 7:66636540-66636562 TTGAGGTAGCAGCATTATCTTGG + Intronic
1026016327 7:66673647-66673669 TTGAGGTAGCAGCATTATCTTGG + Intronic
1028549075 7:92036960-92036982 ATATGGTACCAGGATTATCTGGG + Intronic
1030875674 7:114810404-114810426 CAGGGCCACCAGGATTATCAAGG - Intergenic
1032046881 7:128618713-128618735 CAGGGGTACCAGGATTAGGTTGG + Intergenic
1032443237 7:131958605-131958627 TTGGGGACCCAGGCTTATCTTGG - Intergenic
1041221430 8:55655464-55655486 TATGTTTACCAGGATTACCTGGG - Intergenic
1041236353 8:55806760-55806782 TAGGTGTGCCAGTATAATCTTGG - Intronic
1041810155 8:61899706-61899728 TTGGGGTCCCAAGATAATCTGGG + Intergenic
1043942422 8:86210808-86210830 TAGGGCTTCCAAGGTTATCTTGG - Intergenic
1053334083 9:37248425-37248447 TAGTGGTTCCTGTATTATCTGGG + Intronic
1062132684 9:134908508-134908530 TAGGCCTACCTGGATGATCTGGG - Intronic
1189631178 X:42955016-42955038 TAGGGAGATTAGGATTATCTGGG + Intergenic
1192350946 X:70355660-70355682 TAGGGGTACCAACATCACCTGGG + Intronic
1192864926 X:75120851-75120873 TTGAGGTCCCAGGATAATCTGGG - Intronic
1198420323 X:136465243-136465265 TAGGGGGAGCAGGCTTCTCTTGG + Intergenic
1199336569 X:146625010-146625032 TTGGTGTACCTGGATAATCTAGG + Intergenic
1199948594 X:152687342-152687364 TATGTGTACCTGGATTTTCTTGG + Intergenic
1199961084 X:152781107-152781129 TATGTGTACCTGGATTTTCTTGG - Intergenic
1200183631 X:154167392-154167414 TAGGGCCACCAGGATAATCTAGG - Intergenic
1200189285 X:154204520-154204542 TAGGGCCACCAGGATAATCTAGG - Intergenic
1200195040 X:154242329-154242351 TAGGGCCACCAGGATAATCTAGG - Intergenic
1200200690 X:154279450-154279472 TAGGGCCACCAGGATAATCTAGG - Intronic