ID: 1004123705

View in Genome Browser
Species Human (GRCh38)
Location 6:12851594-12851616
Sequence CTGTGTAATTACATATATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004123705 Original CRISPR CTGTGTAATTACATATATGC CGG (reversed) Intronic
901894398 1:12298003-12298025 CTATGTATTTATATATATACAGG - Intronic
905008758 1:34732403-34732425 GTGTGGAATTCCATATAGGCGGG + Intronic
907026194 1:51122323-51122345 CTGTGCACTTATATATATGTTGG - Intronic
917454402 1:175173803-175173825 ATGTATAACTCCATATATGCTGG + Intronic
918440835 1:184565722-184565744 ATGTGTAATTTCACACATGCAGG - Intronic
922644616 1:227274076-227274098 CTATGGAATTACATATATTTGGG + Intronic
923002790 1:230021480-230021502 CTTTGTAATCACATGTATGATGG + Intergenic
924487946 1:244505647-244505669 CTGACTAATAACATGTATGCTGG - Intronic
1067473611 10:46552502-46552524 CTGTGTAATTACAAATGTCCTGG + Intronic
1070864463 10:79698925-79698947 AAGTGTGATTACATATGTGCAGG - Intergenic
1071631362 10:87221155-87221177 AAGTGTGATTACATATGTGCAGG - Intergenic
1080424257 11:32141889-32141911 TTATGTATGTACATATATGCTGG + Intergenic
1080601292 11:33822473-33822495 CCTTGTAAATACATATATGGGGG - Intergenic
1081999575 11:47386596-47386618 ATGCTAAATTACATATATGCAGG + Intergenic
1082776357 11:57247738-57247760 ATGAGTAATTACAAACATGCTGG - Intergenic
1084782807 11:71422108-71422130 ATGTGTATATATATATATGCAGG + Intergenic
1084843599 11:71880072-71880094 CTGTATAATTATATAAATGATGG + Intronic
1085775439 11:79361794-79361816 CTGTGGGATTTCAAATATGCTGG + Intronic
1086416712 11:86596150-86596172 CTATGAAATTACATATTTGAAGG + Intronic
1089830637 11:121324559-121324581 CTGAGTAATTAAATACATGAAGG - Intergenic
1091863622 12:3809990-3810012 CTGCACAATTACACATATGCTGG + Exonic
1092889264 12:12953475-12953497 CTGTCGAAATACATATATTCAGG - Intergenic
1093831835 12:23770445-23770467 GTGTGTGATTTCATAAATGCTGG + Intronic
1096197975 12:49661123-49661145 TTATGTAATTTCATATATTCAGG + Intronic
1096741919 12:53699762-53699784 CTGTGTAATTAGATCTCTCCTGG + Intergenic
1097219170 12:57436961-57436983 CTCTGTAAAAAAATATATGCTGG - Intronic
1100870907 12:98908959-98908981 GTGTGTGATTAGATAAATGCGGG + Intronic
1101935044 12:109050532-109050554 CTGAGTAATTGCATTCATGCTGG - Intronic
1103309359 12:119991787-119991809 GTGTGCAATTACATACATTCTGG + Intronic
1106291540 13:28367661-28367683 CTATTTGATTACATAAATGCAGG + Intronic
1107195868 13:37650699-37650721 TTGAGTAATTACACATATTCTGG + Intronic
1108070867 13:46627285-46627307 CTGTGTGATTCTATATATGCCGG + Intronic
1108722804 13:53149126-53149148 GTGTGACATTACATATCTGCAGG - Intergenic
1112131956 13:96534330-96534352 CTGTATTATTAAATATCTGCAGG + Intronic
1112973926 13:105293635-105293657 ATGTTTTATTACATATAAGCGGG + Intergenic
1115211980 14:30976730-30976752 ATGTTTAATTTCCTATATGCTGG - Intronic
1116599562 14:46902460-46902482 CTATGTATTCAAATATATGCTGG - Intronic
1117360390 14:54967156-54967178 CTGTATAATTACATAAATAGGGG - Intronic
1118826378 14:69386535-69386557 CTGTGTAAGTACGTATATTTTGG - Intronic
1125684228 15:41554021-41554043 ATGTGTAATTCCACATGTGCTGG - Intergenic
1130628396 15:85539693-85539715 CTTTCTATTTACTTATATGCTGG - Intronic
1130811960 15:87389211-87389233 CTGTGTGATTCGATTTATGCAGG + Intergenic
1139518394 16:67465315-67465337 ATGTATAGGTACATATATGCAGG - Intronic
1140499112 16:75417838-75417860 CTGTGTAGTAACATCAATGCTGG + Intronic
1141788692 16:86218392-86218414 ATCTTTAATTACATCTATGCAGG - Intergenic
1142516763 17:436118-436140 CTGTGGAATCACAGAAATGCTGG + Intergenic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1148099311 17:45078483-45078505 CTGTGTATATATATATATACAGG - Intronic
1149081664 17:52665601-52665623 CTGTGATCTTACATATTTGCAGG + Intergenic
1149407304 17:56366957-56366979 CTGTGTAATTTCCTACATGAGGG - Intronic
1149623954 17:58066561-58066583 CTCTGTAATTACAGACATGCAGG - Intergenic
1149654190 17:58301744-58301766 CTGAGTATATACATATATACAGG + Intronic
1150972951 17:70050740-70050762 TAATGTAATTACATTTATGCAGG - Intergenic
1153777408 18:8466131-8466153 TTGTGTAATTAAATATGTGCAGG + Intergenic
1156993823 18:43442198-43442220 CAGTGTAAATACATATTTTCAGG + Intergenic
1157687940 18:49657883-49657905 GTGTGTATTTAAATATATACTGG - Intergenic
1160024285 18:75205532-75205554 CTTTTTAAGTACATATAAGCTGG - Intronic
1161895521 19:7076525-7076547 CTGAGTCATTAAATAAATGCAGG - Intronic
1162768205 19:12933054-12933076 CTTTGCAATTACAGCTATGCTGG + Intronic
1164125195 19:22308223-22308245 CTGTGAGATTATATATATGATGG - Intronic
1164942191 19:32259328-32259350 CCAAGTAATTACATATTTGCAGG - Intergenic
1165216591 19:34278572-34278594 CTGTGTGATTCCATATATATGGG - Intronic
1165809486 19:38602373-38602395 ATGTGTATATATATATATGCTGG - Intronic
1165935660 19:39387039-39387061 CGGTGTATTTACATAAATACGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929205149 2:39283087-39283109 CTGTGTAAGTAGGTATATACAGG - Intronic
929737433 2:44564876-44564898 TAGTGTCATTACATATATGCAGG + Intronic
931663275 2:64589927-64589949 CTATGCAAATACATATATGGGGG + Intronic
933559382 2:83872976-83872998 CTTTGTAATTGCCTATATGGTGG - Intergenic
933892210 2:86782241-86782263 ATATGTAATAACATATATACTGG + Intergenic
934986138 2:98886330-98886352 CTGTGAAGTTAAATATTTGCCGG - Intronic
937191875 2:120110136-120110158 CTGTGGGATTAGAAATATGCAGG - Intronic
939470962 2:142619053-142619075 TTGTGTAATAACATATATTTTGG + Intergenic
941207691 2:162594464-162594486 CTGTGTTATTACAGTAATGCTGG - Intronic
942095170 2:172530416-172530438 TTGTATATTTACATATATGGAGG - Intergenic
943638244 2:190330166-190330188 CTGTTTAGTTAAATATATTCTGG - Intronic
945374892 2:209068174-209068196 CCGTGTACTTACTTATATGTGGG + Intergenic
945584894 2:211648531-211648553 TTGTGAAATAACATATATGGAGG + Intronic
946756166 2:222949964-222949986 CTGTGTCAGTACATATATAATGG + Intergenic
947276780 2:228401203-228401225 CTGTGTAAGCACCTATCTGCTGG - Intergenic
948665346 2:239531234-239531256 CTTTGTCATTCCATACATGCTGG - Intergenic
1179496393 21:41774331-41774353 CTGTAATAATACATATATGCTGG + Intergenic
1180896210 22:19334741-19334763 TTGTGTTATTACATGTAAGCTGG + Intronic
1183763806 22:39851412-39851434 CTGTGTATTTACATAAATAAAGG - Intronic
1184847106 22:47095287-47095309 CTATGTAAATACGCATATGCGGG + Intronic
1184971117 22:48020755-48020777 CTGTGTAATTACCTAAATTAAGG - Intergenic
949181634 3:1138182-1138204 CTGTGTAGTTACACAAGTGCAGG + Intronic
949606691 3:5661282-5661304 GTGTGTAAATTAATATATGCTGG + Intergenic
949655687 3:6216170-6216192 ATATGCAATTAAATATATGCTGG - Intergenic
951578319 3:24135875-24135897 CTATATAATTATATATATGTAGG + Intronic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955139774 3:56257807-56257829 CTCTGTAATTACTAACATGCTGG - Intronic
955232478 3:57111188-57111210 CTGTGTAATTACTTTTGTCCTGG - Intronic
960542229 3:118873794-118873816 CTGTGTCCTCACATATTTGCAGG - Intergenic
963237694 3:142971937-142971959 CTGTGTTTTTACACACATGCTGG + Intronic
963506796 3:146196205-146196227 CTGTGGAAATACTTATTTGCAGG - Intronic
963514956 3:146297693-146297715 TTATGTAAATACAAATATGCAGG - Intergenic
966070287 3:175869107-175869129 CTGTGTATTTATATACATACAGG + Intergenic
967261024 3:187642430-187642452 TGGTGTAATTACATATTAGCCGG + Intergenic
970503175 4:16699502-16699524 TTGTGTAATTAGGTATATGATGG + Intronic
970686314 4:18571699-18571721 CTGTGTAATTAAATGGTTGCAGG + Intergenic
972011976 4:34194412-34194434 CTATGTTGTTACCTATATGCAGG - Intergenic
976413843 4:84748397-84748419 CTGAGGAATTACATGTGTGCTGG - Intronic
976776954 4:88717675-88717697 CTGGGTAATTTCATATGTTCTGG + Intergenic
978840504 4:113206614-113206636 CTGGGTGATTACAAATTTGCAGG + Intronic
979515043 4:121598049-121598071 CTTTGTAAATACATATATGAGGG - Intergenic
979748876 4:124251221-124251243 CTGTGGAAGAACATATATGCTGG + Intergenic
980620715 4:135299283-135299305 ATATGTAAATAAATATATGCGGG - Intergenic
982477957 4:155876252-155876274 CTGTGTAGTTATATATGTGTTGG - Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
985124427 4:186678676-186678698 CCCTGTAATTTCTTATATGCAGG - Intronic
986085970 5:4447248-4447270 CTGTGTAACAACATATTTACAGG - Intergenic
987758369 5:22126126-22126148 ATGTGTACTTATATATATGCAGG - Intronic
987938261 5:24498059-24498081 CTGTGTCATTAAATAAATACTGG - Intronic
988702271 5:33687137-33687159 CTGAGTAACTACCTATTTGCTGG - Intronic
989475191 5:41866950-41866972 CTGTGTGGTTACAGACATGCGGG + Intronic
990242090 5:53826028-53826050 CTGTGTGATTACATTTATATGGG + Intergenic
991158766 5:63470067-63470089 CTGTGTCATTCCAGCTATGCTGG - Intergenic
991749126 5:69780263-69780285 ATGTGTACTTATATCTATGCAGG - Intergenic
991800707 5:70360074-70360096 ATGTGTACTTATATCTATGCAGG - Intergenic
991827893 5:70649967-70649989 ATGTGTACTTATATCTATGCAGG + Intergenic
993140888 5:84031868-84031890 CAGTGTAATTTCCAATATGCTGG + Intronic
994514020 5:100746932-100746954 CTGTGTACTTCCCTATATGGAGG + Intergenic
994656130 5:102594884-102594906 CTGTGTATTTAAAAATATGGTGG + Intergenic
994967906 5:106698006-106698028 CTGGGGAATTACATGCATGCTGG - Intergenic
994985308 5:106925911-106925933 CTCTGGAATTACATATGTGACGG + Intergenic
997764058 5:136481532-136481554 TTATGTAATTACACATAGGCTGG + Intergenic
997781316 5:136661652-136661674 CTGAGTAATTATAGATATGCTGG + Intergenic
997912611 5:137890572-137890594 CTGTGTACTTACATATACATAGG - Exonic
1001927986 5:175653010-175653032 CTGTGCAATTTCAGAGATGCTGG + Intergenic
1004123705 6:12851594-12851616 CTGTGTAATTACATATATGCCGG - Intronic
1013786158 6:113783629-113783651 CTGTGTAGTTACAGAGCTGCTGG - Intergenic
1014008496 6:116449307-116449329 CTGTATAATTACAACTATTCTGG - Intergenic
1014508581 6:122291386-122291408 GTGTGTATATATATATATGCAGG + Intergenic
1015137467 6:129890031-129890053 GTGTGTATATACATATATGATGG + Intergenic
1018338628 6:162824479-162824501 CTGTATAATAACAAATGTGCAGG - Intronic
1018929367 6:168230345-168230367 GTGTGTACATACATATATGTAGG + Intergenic
1020852977 7:13380063-13380085 TTTTGTAATTAAATTTATGCAGG - Intergenic
1022198360 7:28092152-28092174 CACTGTAATTACATATATAAAGG + Intronic
1023070779 7:36430776-36430798 CTGTGTAATGTGTTATATGCTGG - Intronic
1024745991 7:52406999-52407021 CTGTGTAATTGCATTTCTGAAGG + Intergenic
1028149578 7:87356560-87356582 CTGTTTAATTTCATAGTTGCAGG + Intronic
1028792913 7:94873923-94873945 CTGTATGTTTACGTATATGCAGG + Intergenic
1030201055 7:106904906-106904928 CCGTGTAGTTGCATATATCCAGG - Intronic
1035527097 8:322493-322515 AAGTGTAACTACTTATATGCTGG + Intergenic
1036829107 8:12008030-12008052 CTGTATAATTATATAAATGATGG - Intergenic
1036834339 8:12047986-12048008 CTGTATAATTATATAAATGATGG - Intergenic
1036856184 8:12294550-12294572 CTGTATAATTATATAAATGATGG - Intergenic
1037347754 8:17917565-17917587 CTATGTAACTAGATATATGTTGG - Intergenic
1039579769 8:38655290-38655312 CTGAGTAGTTACACATATGAGGG - Intergenic
1039655507 8:39400351-39400373 CAGTATAATTCCATCTATGCTGG + Intergenic
1041488406 8:58404966-58404988 TTGTGTAATTTTACATATGCTGG - Intergenic
1041842188 8:62284815-62284837 CTATGTAATTACCTAAATGCAGG + Intronic
1042709386 8:71698720-71698742 TTATGTAATAACATGTATGCTGG + Intergenic
1043515977 8:80995259-80995281 CTCTATAATTATATAAATGCAGG + Intronic
1043927025 8:86048904-86048926 CTGTGTCATTACATATATAGAGG + Intronic
1043989069 8:86730273-86730295 CAGTGACATTACATAAATGCTGG + Intronic
1045546019 8:103129246-103129268 CTTGGTAATTAAATATATGATGG - Intergenic
1047132712 8:122038771-122038793 CTGTGTAATTACTTATGCCCTGG + Intergenic
1050380441 9:5022448-5022470 CTTTATAATTACATATAAGGTGG + Intronic
1054381001 9:64488993-64489015 CTGTATAATTAAATATTTGTAGG - Intergenic
1057356288 9:94334325-94334347 AGGTGTGATTACATATGTGCAGG + Intergenic
1057633648 9:96742100-96742122 CTGTGTAACCACATAGATGGAGG + Intergenic
1057651462 9:96923303-96923325 AGGTGTGATTACATATGTGCAGG - Intronic
1058316404 9:103572152-103572174 CTTTGCAATTAAATATATGATGG + Intergenic
1187962230 X:24577573-24577595 CTCTGTAACTTCATATAAGCCGG - Intronic
1190443619 X:50500900-50500922 CTCTTTAATTACAGATATTCTGG + Intergenic
1190628803 X:52365229-52365251 CTCTGTAATTACATATTTCGTGG - Intergenic
1197136260 X:123063462-123063484 CTGTGTAAATAAATATATATGGG - Intergenic
1198053858 X:132974966-132974988 CTGTGTAATTACATACCCACAGG + Intergenic
1198954780 X:142116750-142116772 TTGTGGAACTACATATATGTAGG + Intergenic
1199414303 X:147562509-147562531 CTATATACTTACATATATGTAGG - Intergenic
1200040326 X:153360917-153360939 TTGTGTGTGTACATATATGCAGG - Intergenic